SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g47590

Feature Type:gene_model
Chromosome:Gm08
Start:46406239
stop:46408371
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g47590
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G13140AT Annotation by Michelle Graham. TAIR10: Pollen Ole e 1 allergen and extensin family protein | chr5:4170688-4171744 REVERSE LENGTH=267 SoyBaseE_val: 9.00E-60ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010015GO-bp Annotation by Michelle Graham. GO Biological Process: root morphogenesis SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0040007GO-bp Annotation by Michelle Graham. GO Biological Process: growth SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF01190PFAM Pollen proteins Ole e I like JGI ISS
UniRef100_B9RM98UniRef Annotation by Michelle Graham. Most informative UniRef hit: Hydrolase, acting on ester bonds, putative n=1 Tax=Ricinus communis RepID=B9RM98_RICCO SoyBaseE_val: 8.00E-64ISS
UniRef100_I1KZG6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZG6_SOYBN SoyBaseE_val: 2.00E-176ISS

Expression Patterns of Glyma08g47590
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g47590
ParalogEvidenceComments
Glyma18g53890 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g47590 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g360800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g47590
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g47590
>Glyma08g47590.1   sequence type=CDS   gene model=Glyma08g47590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATCAATTTCCTATTCTCCTTCTTCTTTTTGTTACATCTCTCTTCAGTTGCCCATTTGTGCTCATTGCTCAATCTCCAAGTCCAATTATCTCTCACATCAGTGTGGTGGGAGCTGTTTATTGTGATACCTGCTCCACCAGCACTTTCTCTAAACAGAGCTACTTCTTGCAAGGTGTTGAGGTTCACATACAGTGCAGATTTAGAGCAACCTCACCAAAAACTAGCGAGCAGATAAGCTTCTCAGTGAACAGAACCACAGACCAATATGGAGTGTACAAGTTGGACATACCATCGGTGGATGGAGTTAACTGCATGGATGGTTCAACAATTGTGTCACTCTGCCAAGCAACTTTGATAAGTAGCTCCACTTCCACTTGCAATGTTCCCTTTCTCAAGAGCACAACACGTCAGATATCAGTCAAATCAAAACAAGATAACCTGTGTGTATACACCTTGAGTGGCCTCAGTTACAAGCCACCTCAAAAGAACACTACCTTGTGTGGACATGATCAGCAATTGCAATTACCAAATTCTCTCAACTCCTCAAAATGCTACTTCCCTTGGCCTCAGCTACCATTCCCTCCTTTGCAATCAATGCCACCAATACCATCTCTGCCTTTCCCTTTCCCACAATATCCTCCAACCCCATCAACTTGGCTACCTCCTATCCCTTCCCTTTCTCATCCTCCACCCTCCACTTGGATCCCTCATATTCCGCCTAATATACCACAATCACAACACCAAACTCCCTAG
Predicted protein sequences of Glyma08g47590
>Glyma08g47590.1   sequence type=predicted peptide   gene model=Glyma08g47590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDQFPILLLLFVTSLFSCPFVLIAQSPSPIISHISVVGAVYCDTCSTSTFSKQSYFLQGVEVHIQCRFRATSPKTSEQISFSVNRTTDQYGVYKLDIPSVDGVNCMDGSTIVSLCQATLISSSTSTCNVPFLKSTTRQISVKSKQDNLCVYTLSGLSYKPPQKNTTLCGHDQQLQLPNSLNSSKCYFPWPQLPFPPLQSMPPIPSLPFPFPQYPPTPSTWLPPIPSLSHPPPSTWIPHIPPNIPQSQHQTP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo