SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g47300

Feature Type:gene_model
Chromosome:Gm08
Start:46186912
stop:46190120
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g47300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G46510AT Annotation by Michelle Graham. TAIR10: plant U-box 13 | chr3:17124106-17126539 REVERSE LENGTH=660 SoyBaseE_val: 1.00E-18ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006487GO-bp Annotation by Michelle Graham. GO Biological Process: protein N-linked glycosylation SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0032880GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein localization SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0070696GO-mf Annotation by Michelle Graham. GO Molecular Function: transmembrane receptor protein serine/threonine kinase binding SoyBaseN/AISS
PTHR23315Panther BETA CATENIN-RELATED ARMADILLO REPEAT-CONTAINING JGI ISS
PTHR23315:SF7Panther UNCHARACTERIZED JGI ISS
PF04564PFAM U-box domain JGI ISS
UniRef100_B9T786UniRef Annotation by Michelle Graham. Most informative UniRef hit: Spotted leaf protein, putative n=1 Tax=Ricinus communis RepID=B9T786_RICCO SoyBaseE_val: 3.00E-18ISS
UniRef100_I1KZD8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZD8_SOYBN SoyBaseE_val: 2.00E-140ISS

Expression Patterns of Glyma08g47300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g47300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g358200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g47300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g47300
>Glyma08g47300.1   sequence type=CDS   gene model=Glyma08g47300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATCTGGAAACAATATTGTGTCACCAACTGAGGATTTCTCTCGTCATACTCATGAGCCATATGCGAAACTATGTCCAGAATCACTGCATATACCTTATGAGTTTCGTTGTCCAATTTCTCTAGTGATAATGAAAGATCCTGTTATCATTTGCACAGGGCAGTTCCAAGTATGCATGACACCTACCCCTGGTGGCCTGGTGAACTCGATGACGTTGATACATTTTACTGCAGGGGAGCTCCGACTTCTCACCAAGAAAAATGGTCAAAATCGAATGCTGATTGCTGAAGCGGGTGCTATCCCCTGCCTTGTTGATCTCCTCTATGCACTTGACACCCAAACAAGGAACAAAGGACAGGCAATTACAGCCAGTATTGTGCCTAAGTTGATAGAAATGCTAACAGAACCTGATGGGGATATGAGGGATGAGGCATTCGCAGTAATGGCTGTAGTAGCTGCTGGCCATTCCGATGGACAAGCAACAATTGGATCTATGAATGTTGTATCCACTTTGGTGGAATTAGTCAGTAATGGACCTCCTAGGAACAAAGAGAATGCAACTTCAGTGTTGGTTATCCTATGA
Predicted protein sequences of Glyma08g47300
>Glyma08g47300.1   sequence type=predicted peptide   gene model=Glyma08g47300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESGNNIVSPTEDFSRHTHEPYAKLCPESLHIPYEFRCPISLVIMKDPVIICTGQFQVCMTPTPGGLVNSMTLIHFTAGELRLLTKKNGQNRMLIAEAGAIPCLVDLLYALDTQTRNKGQAITASIVPKLIEMLTEPDGDMRDEAFAVMAVVAAGHSDGQATIGSMNVVSTLVELVSNGPPRNKENATSVLVIL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo