Report for Sequence Feature Glyma08g47210
Feature Type: gene_model
Chromosome: Gm08
Start: 46131425
stop: 46135370
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g47210
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G13220 AT
Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 27 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr4:7674431-7675275 REVERSE LENGTH=176
SoyBase E_val: 5.00E-53 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1KZD1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZD1_SOYBN
SoyBase E_val: 6.00E-127 ISS
UniRef100_Q2QU14 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=2 Tax=Oryza sativa RepID=Q2QU14_ORYSJ
SoyBase E_val: 4.00E-41 ISS
Expression Patterns of Glyma08g47210
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma08g47210
Paralog Evidence Comments
Glyma18g38450 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g47210 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g357300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g47210
Coding sequences of Glyma08g47210
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g47210.1 sequence type=CDS gene model=Glyma08g47210 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCTGCTTCAACTGTTGTTCACAATTTTTGTTCTGTCGCTTCTTGCATTTCAAATTGCCGCCAAAAACGAACATTGGTTCCCACCCATCATGCGTTTCATTCACCCAATTCCCTTTTGAGGTTAAAGAAGCAATCTTTCCTCTTAAATACTCACTTCAAGAGTTCCAGAACCCAGAAACCTCCCTCCAGTTTTGTGGTTTCCGCAGCACAATCGAATTTTGTTAAAGTTCTGCAGAATGCATGGAAAGTTGGTAGGGATGGAATTGAGGCAGGCACTAATCTTGCTCCTAATTCTGTACCAAGGCCAATAGCAAGGATTTCAGTAACAATTGTGGCTTTGAGTGTTACGCTTTTTGTACTCAAGGCATTCCTCTCTACAGCTTTCTTTATATTGGCCACTATAGGACTTGCATACTTTGCATACCTAGCATTCAATAAAGATCAAGGACCTAGTGGGAATGGAGGAACTGCCTCTACACCAATGGATGATCCAGTGGAAGAAGCCAGAAAGATAATGGAAAAATACAAGTAG
Predicted protein sequences of Glyma08g47210
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g47210.1 sequence type=predicted peptide gene model=Glyma08g47210 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSASTVVHNFCSVASCISNCRQKRTLVPTHHAFHSPNSLLRLKKQSFLLNTHFKSSRTQKPPSSFVVSAAQSNFVKVLQNAWKVGRDGIEAGTNLAPNSVPRPIARISVTIVALSVTLFVLKAFLSTAFFILATIGLAYFAYLAFNKDQGPSGNGGTASTPMDDPVEEARKIMEKYK*