SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g46890

Feature Type:gene_model
Chromosome:Gm08
Start:45851806
stop:45855216
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g46890
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G48820AT Annotation by Michelle Graham. TAIR10: inhibitor/interactor with cyclin-dependent kinase | chr5:19792608-19794346 REVERSE LENGTH=222 SoyBaseE_val: 1.00E-51ISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000278GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0007050GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle arrest SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010440GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression SoyBaseN/AISS
GO:0016569GO-bp Annotation by Michelle Graham. GO Biological Process: covalent chromatin modification SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0045736GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004861GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase inhibitor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0030332GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin binding SoyBaseN/AISS
PF02234PFAM Cyclin-dependent kinase inhibitor JGI ISS
UniRef100_G7L186UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cyclin dependent kinase inhibitor n=1 Tax=Medicago truncatula RepID=G7L186_MEDTR SoyBaseE_val: 6.00E-86ISS
UniRef100_I1KZ97UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZ97_SOYBN SoyBaseE_val: 5.00E-148ISS

Expression Patterns of Glyma08g46890
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g46890
ParalogEvidenceComments
Glyma18g36820 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g46890 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g354300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g46890
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g46890
>Glyma08g46890.1   sequence type=CDS   gene model=Glyma08g46890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCAAGTACATGAAGAAGTCCAAAATCGCCGGCGACGTCGCCGCCGTGATCATGGAGGCTCCGCCGCCGCACTCCCACCTCGGCGTCCGCACCCGCGCCAAGACCCTCGCTCTCCAGAACAACACCACCTCCCCGGACCCCTCCGCCTACCTCCAGCTCCGCAGCCGCCGCCTCCTCAAGCTCCCCCCTACCCCGCCGGAAAATCCCCGCCGCTCCTCCGCCGAAACCGCCGCCAATTTCCGCCTCGCCAACGCCCAAAAGCTTGCATCTTTCGAAGACGACAACAACACCGAATGCTCTTTCGGCGAGAATTTCTTAGACGCCGAGCCCAGAGAAGAAAGGAGCACCAGGGAAGGCACCCCTTGTAGTTTAATAAGGGACTCAAATGCCATTCATACCCCTGGTTCAACCACAAGGCCAAGGACTCGCCAAATAATCCATGAACACGTACAAAGAAATATTCCAACGGCTTATGAGATGGAGGAGTTCTTTGCTTATGCTGAGAAGCAGCAACAGACAATATTTATGGACAAGTACAATTTCGACATTGTCAATGACGTACCTCTGCCTGGACGGTACGAGTGGGTCCCAGTACTCCACTAG
Predicted protein sequences of Glyma08g46890
>Glyma08g46890.1   sequence type=predicted peptide   gene model=Glyma08g46890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKYMKKSKIAGDVAAVIMEAPPPHSHLGVRTRAKTLALQNNTTSPDPSAYLQLRSRRLLKLPPTPPENPRRSSAETAANFRLANAQKLASFEDDNNTECSFGENFLDAEPREERSTREGTPCSLIRDSNAIHTPGSTTRPRTRQIIHEHVQRNIPTAYEMEEFFAYAEKQQQTIFMDKYNFDIVNDVPLPGRYEWVPVLH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo