SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g45990

Feature Type:gene_model
Chromosome:Gm08
Start:45223854
stop:45229873
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g45990
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G05990AT Annotation by Michelle Graham. TAIR10: NAD(P)-binding Rossmann-fold superfamily protein | chr2:2322876-2324867 FORWARD LENGTH=390 SoyBaseE_val: 0ISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005835GO-cc Annotation by Michelle Graham. GO Cellular Compartment: fatty acid synthase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004318GO-mf Annotation by Michelle Graham. GO Molecular Function: enoyl-[acyl-carrier-protein] reductase (NADH) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016631GO-mf Annotation by Michelle Graham. GO Molecular Function: enoyl-[acyl-carrier-protein] reductase activity SoyBaseN/AISS
KOG0725 KOG Reductases with broad range of substrate specificities JGI ISS
UniRef100_E6Y9A9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Enoyl-ACP reductase n=1 Tax=Arachis hypogaea RepID=E6Y9A9_ARAHY SoyBaseE_val: 0ISS
UniRef100_I1KZ09UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KZ09_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g45990
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g45990 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g345900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g45990
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g45990
>Glyma08g45990.1   sequence type=CDS   gene model=Glyma08g45990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAACAACAGTTTCCAACTTGCCAACTGCTATGTCAAGACCCAAGATTCCTTCATCACAAAGGATTGCAAATGTAGGTCCTGCACTTCTTGGAGCCAGATCTAAGGTTGGTTCATGTTATAAACTGGCAAGTGTTTGTCATGTTGCGTCAGCACAACCTTTCCAGCAGGGGTTGACAATGACATCAGGTGCTGTAAAATATGACAAAATCATAACAAAGGCAATGTCCGAGTCTAGTTCAAACAAGGAAGTTGCAGGATTGCCAATTGATTTGAAAGGTAAAAGGGCTTTCATTGCTGGTGTGGCTGATGACAATGGATATGGCTGGGCAATAGCAAAATCTCTTGCAGCAGCAGGAGCTGAAATTCTTGTCGGCACATGGGTACCTGCTTTAAATATATTTGAGTCCAGTCTACGACGTGGAAAATTTGACGAGTCACGCAAATTACAAGATGGTTCATTGATGGAGATTGCTAAAGTGTATCCTTTGGATGCAGTATATGACAGTCCTGAAGATGTCCCGGAAGATGTGAAAGCTAACAAGCGCTATGCTGGAGCCACAAATTGGACTGTACAGGAAGTTGCTGAATCTGTCAAGAAGGATTTTGGCACTATCGACATACTTGTGCACTCGCTTGCTAATGGACCAGAGGTCAGCAAACTATTGTCCGAGACATCTCGGAAAGGATATCTTGCTGCCCTGTCTGCATCAAGTTACTCTTATATTTCTTTACTCAAACACTTTCTTCCAATCATGAACCCAGATGGATCTGCAATTTCTCTTACATACATTGCTTCAGAAAGGATCATTCCTGGATATGGTGGTGGTATGAGTTCTGCAAAAGCTGCTTTAGAAAGTGATACAAGAGTGCTTGCTTTTGAAGCTGGTAGAAAGAAAAGAATCAGAGTCAATACTATATCTGCAGGTCCATTGGGAAGCCGTGCAGCAAAAGCAATTGGCTTCATTGACATGATGATTGACTATTCGTTTACCAATGCACCACTGCAGAAAGAACTACATGCTGAGGAGGTTGGCAACACTGCTGCTTTCTTGTCATCACCCTTGGCATCAGCTATCACAGGTGCTGTTATATATGTTGACAATGGTCTAAACGCCATGGGGGTTGGAGTTGACAGTCCAATATTTAAAGAACTTGACATTCCAAAAGAGCATCATTGA
Predicted protein sequences of Glyma08g45990
>Glyma08g45990.1   sequence type=predicted peptide   gene model=Glyma08g45990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATTVSNLPTAMSRPKIPSSQRIANVGPALLGARSKVGSCYKLASVCHVASAQPFQQGLTMTSGAVKYDKIITKAMSESSSNKEVAGLPIDLKGKRAFIAGVADDNGYGWAIAKSLAAAGAEILVGTWVPALNIFESSLRRGKFDESRKLQDGSLMEIAKVYPLDAVYDSPEDVPEDVKANKRYAGATNWTVQEVAESVKKDFGTIDILVHSLANGPEVSKLLSETSRKGYLAALSASSYSYISLLKHFLPIMNPDGSAISLTYIASERIIPGYGGGMSSAKAALESDTRVLAFEAGRKKRIRVNTISAGPLGSRAAKAIGFIDMMIDYSFTNAPLQKELHAEEVGNTAAFLSSPLASAITGAVIYVDNGLNAMGVGVDSPIFKELDIPKEHH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo