SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g45810

Feature Type:gene_model
Chromosome:Gm08
Start:45086009
stop:45087473
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g45810
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G48480AT Annotation by Michelle Graham. TAIR10: Lactoylglutathione lyase / glyoxalase I family protein | chr5:19644814-19645658 FORWARD LENGTH=166 SoyBaseE_val: 2.00E-33ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_C6SZI9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SZI9_SOYBN SoyBaseE_val: 3.00E-112ISS
UniRef100_G7KZ23UniRef Annotation by Michelle Graham. Most informative UniRef hit: Early tobacco anther n=1 Tax=Medicago truncatula RepID=G7KZ23_MEDTR SoyBaseE_val: 1.00E-70ISS

Expression Patterns of Glyma08g45810
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g45810 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g344200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g45810
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g45810
>Glyma08g45810.1   sequence type=CDS   gene model=Glyma08g45810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAGCAAGACGCTCAAAACGGCGGGTCGGAGAATGCCGCTGCTGCTGCTACGGTGTCGTTTGTCGCTGTGAAGCCGCAGCTCCTCGTCGAAGCTCCCAAAGCCAACGACGCCATTCTGTTCTTCAAGGCTGCGTTTGGCGCTGAGGAAGTTGGCCGTACGCTCAACCCTAAGCGCAAAGCTGAGCACGAGCTCCCTCTCATACTCTCCGCAGAACTCAAAATCGCTGGCTCCACCATTCTCGTCGCCGACCTCGTTGATGACACTTCTTCGCCAGCGAAAACGGGGGGAAACGGTGTCGTTTTGTGCTTGGAGACGGAGGACGTGGATGGGGCAGTAGCTAAGGCGGTGAGCGCTGGTGCAGTTGCGGAGGGCGAAGTAGCGGAAGGTGAAGTCGCGTGCTGCGGCGGGCGCGTGGGGAAGGTTAAGGACCCGTATGGCTTCGTTTGGCTCTTCTGCACTCCAGGGAAGAAGTGTGCTGACGTGGAGGCTTAA
Predicted protein sequences of Glyma08g45810
>Glyma08g45810.1   sequence type=predicted peptide   gene model=Glyma08g45810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQQDAQNGGSENAAAAATVSFVAVKPQLLVEAPKANDAILFFKAAFGAEEVGRTLNPKRKAEHELPLILSAELKIAGSTILVADLVDDTSSPAKTGGNGVVLCLETEDVDGAVAKAVSAGAVAEGEVAEGEVACCGGRVGKVKDPYGFVWLFCTPGKKCADVEA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo