SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g45440

Feature Type:gene_model
Chromosome:Gm08
Start:44823350
stop:44827720
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g45440
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02160AT Annotation by Michelle Graham. TAIR10: Cox19 family protein (CHCH motif) | chr1:410803-411383 FORWARD LENGTH=71 SoyBaseE_val: 3.00E-30ISS
GO:0006301GO-bp Annotation by Michelle Graham. GO Biological Process: postreplication repair SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG4618 KOG Uncharacterized conserved protein JGI ISS
UniRef100_C6T0X9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T0X9_SOYBN SoyBaseE_val: 5.00E-44ISS
UniRef100_Q8VZ44UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cox19 family protein (CHCH motif) n=1 Tax=Arabidopsis thaliana RepID=Q8VZ44_ARATH SoyBaseE_val: 2.00E-27ISS

Expression Patterns of Glyma08g45440
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g45440 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g340600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g45440
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g45440
>Glyma08g45440.1   sequence type=CDS   gene model=Glyma08g45440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCGAAAGCTCCAACAGCTCCATATCCCAGTGCTGCCAGAATCTCTGATTCTCAGTGTTTTCCGCAATACACCGCTTCTCTCAAATGTTTAGAAGAATTTAATTCTGATAAGAGTAAATGTCAAGAACATTTTGATGTTTACAAGATGTGCAAGAAAAAAGAGAGGGAAGCACGATTGGAACGAAATAAAAACCGATCCTTATTCTCGTGA
Predicted protein sequences of Glyma08g45440
>Glyma08g45440.1   sequence type=predicted peptide   gene model=Glyma08g45440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASKAPTAPYPSAARISDSQCFPQYTASLKCLEEFNSDKSKCQEHFDVYKMCKKKEREARLERNKNRSLFS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo