Glyma08g44560 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g44560

Feature Type:	gene_model
Chromosome:	Gm08
Start:	44137985
stop:	44141864
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g44560

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G56200	AT	Annotation by Michelle Graham. TAIR10: embryo defective 1303 \| chr1:21030852-21031886 FORWARD LENGTH=154	SoyBase	E_val: 1.00E-18	ISS
GO:0006635	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009658	GO-bp	Annotation by Michelle Graham. GO Biological Process: chloroplast organization	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0010027	GO-bp	Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization	SoyBase	N/A	ISS
GO:0016558	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix	SoyBase	N/A	ISS
GO:0031347	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of defense response	SoyBase	N/A	ISS
GO:0048573	GO-bp	Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering	SoyBase	N/A	ISS
GO:0090056	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of chlorophyll metabolic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_A8MS46	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Embryo defective 1303 protein n=1 Tax=Arabidopsis thaliana RepID=A8MS46_ARATH	SoyBase	E_val: 6.00E-16	ISS
UniRef100_C6SXM5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SXM5_SOYBN	SoyBase	E_val: 1.00E-110	ISS

Expression Patterns of Glyma08g44560

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g44560

Paralog	Evidence	Comments
Glyma18g08250	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g44560 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g332600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g44560

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma08g44560

Limit To All Plant Sequences

>Glyma08g44560.2   sequence type=transcript   gene model=Glyma08g44560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TGAAATTTGGAAGGTTTCTTGTGAATTCGAACCAATTTGGTTCTTCTCTTCTCTCTATCGTCTTCTTCCTCTGTTCCATTAGGGTTTCCTTTTCTCCCTCGGAGCTTCCAATTGAAATCCAATTCCTCAATACCTCCACACTTTCTCGTTCGGAAAGCTCGCGAATTCGAAAGACATCGACGGCTCCACGTGATACGTTTTCTTCCTCTCTGGTTATCAATGTTGGCTACTAGTGCAGTTGCATCTTTGCCCGTATTACCACCAGTGAGAAGAGGTGGCCACCACATTGAACAGAATGTTGTTTCCACATTGAGCTTTCCAAGACGATTACTGACAACTAATAATTCAATACCTCTGAGTGGTACACAGTTTCCATTTGGCAGAAGAGCTCATTCTACTCACACAGCAACTATAATATGTGCTGCAGCTTTGAATGCAAGATGTGGTGCAGAGCAAACCCAAACCGTTACTCGCCAGGCTCCTACAATTACTCATGTTCCTGGAAAATATCATGAAACAAGCAAATGTTATTTGTTACTAATAGACTCTTACTCTTCCAAAGCATGTTCTAGATTGTCCATCATGGTTTAATTCAATTGTCAGGCAAGGAGAAGTCGCCACAACTTGACGATGGTGGAACTGGATTTCCACCTCGTGATGATGATGATGGCGGTGGTGGAGGAGGTGGAGGCGGAGGCAACTGGTCTGGTGGATTCTTCTTTTTTGGGTTTCTTGCTTTTCTTGGCTTCTTAAAGGATAAGGAAACTGATGACACATACAGGGATGACCGAAGAAGGTGAAAGCATTGGCCACCACAGATGCATGCTTTTGCTTGGAGTATTTTTTCTGCTTTATTTGTTGATTTCCTCTCTTATATATGCATACCGTAGATTACATTGGTCAACTGAGGTTCTGTGCTTGCTTATGATCATGTAATGCGCAGAATTTTGTATGTTACAAATTAAATCCCACTTGAAACTTTAGTATGGAAGGAAATACCGTGATAATTAGTATCAAATTACATCGGTATAGTAGTTATGCTTTTTGACTTGGATGGTACAAATTAGCATGATACTTAGATGGAGTTTTCATCTGTTACCTTTTCTTGAGAGGAGCACTGTGATAGCATACACTAGGAAATACTCTTTACCTGGTTAATCTTAGTTGAATATTATTTCGTGACAATTGTATGAAGCTCATTTGATTTAGGATACACGTAAAAAATGTTTGAACGAACAAAACAATTGTCACGAGTGAGGTGGGCTTAATTGCTTAAAGCTTGCTCTTTAA

Coding sequences of Glyma08g44560

Limit To All Plant Sequences

>Glyma08g44560.1   sequence type=CDS   gene model=Glyma08g44560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGCTACTAGTGCAGTTGCATCTTTGCCCGTATTACCACCAGTGAGAAGAGGTGGCCACCACATTGAACAGAATGTTGTTTCCACATTGAGCTTTCCAAGACGATTACTGACAACTAATAATTCAATACCTCTGAGTGGTACACAGTTTCCATTTGGCAGAAGAGCTCATTCTACTCACACAGCAACTATAATATGTGCTGCAGCTTTGAATGCAAGATGTGGTGCAGAGCAAACCCAAACCGTTACTCGCCAGGCTCCTACAATTACTCATGTTCCTGGCAAGGAGAAGTCGCCACAACTTGACGATGGTGGAACTGGATTTCCACCTCGTGATGATGATGATGGCGGTGGTGGAGGAGGTGGAGGCGGAGGCAACTGGTCTGGTGGATTCTTCTTTTTTGGGTTTCTTGCTTTTCTTGGCTTCTTAAAGGATAAGGAAACTGATGACACATACAGGGATGACCGAAGAAGGTGA

>Glyma08g44560.2   sequence type=CDS   gene model=Glyma08g44560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGCTACTAGTGCAGTTGCATCTTTGCCCGTATTACCACCAGTGAGAAGAGGTGGCCACCACATTGAACAGAATGTTGTTTCCACATTGAGCTTTCCAAGACGATTACTGACAACTAATAATTCAATACCTCTGAGTGGTACACAGTTTCCATTTGGCAGAAGAGCTCATTCTACTCACACAGCAACTATAATATGTGCTGCAGCTTTGAATGCAAGATGTGGTGCAGAGCAAACCCAAACCGTTACTCGCCAGGCTCCTACAATTACTCATGTTCCTGGAAAATATCATGAAACAAGCAAATGTTATTTGTTACTAATAGACTCTTACTCTTCCAAAGCATGTTCTAGATTGTCCATCATGGTTTAA

Predicted protein sequences of Glyma08g44560

Limit To All Plant Sequences

>Glyma08g44560.1   sequence type=predicted peptide   gene model=Glyma08g44560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLATSAVASLPVLPPVRRGGHHIEQNVVSTLSFPRRLLTTNNSIPLSGTQFPFGRRAHSTHTATIICAAALNARCGAEQTQTVTRQAPTITHVPGKEKSPQLDDGGTGFPPRDDDDGGGGGGGGGGNWSGGFFFFGFLAFLGFLKDKETDDTYRDDRRR*

>Glyma08g44560.2   sequence type=predicted peptide   gene model=Glyma08g44560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLATSAVASLPVLPPVRRGGHHIEQNVVSTLSFPRRLLTTNNSIPLSGTQFPFGRRAHSTHTATIICAAALNARCGAEQTQTVTRQAPTITHVPGKYHETSKCYLLLIDSYSSKACSRLSIMV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain