Glyma08g43541 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g43541): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g43541): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g43541

Feature Type:	gene_model
Chromosome:	Gm08
Start:	43349501
stop:	43352925
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g43541

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G26900	AT	Annotation by Michelle Graham. TAIR10: HIS HF \| chr4:13515514-13519608 FORWARD LENGTH=592	SoyBase	E_val: 5.00E-85	ISS
GO:0000105	GO-bp	Annotation by Michelle Graham. GO Biological Process: histidine biosynthetic process	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0000107	GO-mf	Annotation by Michelle Graham. GO Molecular Function: imidazoleglycerol-phosphate synthase activity	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0016763	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring pentosyl groups	SoyBase	N/A	ISS
GO:0016833	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxo-acid-lyase activity	SoyBase	N/A	ISS
PTHR21235	Panther	IMIDAZOLE GLYCEROL PHOSPHATE SYNTHASE SUBUNIT HISF/H (IGP SYNTHASE SUBUNIT HISF/H)	JGI		ISS
PTHR21235:SF2	Panther	IMIDAZOLE GLYCEROL PHOSPHATE SYNTHASE SUBUNIT HISF (IGP SYNTHASE SUBUNIT HISF)	JGI		ISS
PF00117	PFAM	Glutamine amidotransferase class-I	JGI		ISS
UniRef100_B9SVA2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Imidazole glycerol phosphate synthase subunit hisF n=1 Tax=Ricinus communis RepID=B9SVA2_RICCO	SoyBase	E_val: 5.00E-87	ISS
UniRef100_I1N0Y1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N0Y1_SOYBN	SoyBase	E_val: 8.00E-99	ISS

Expression Patterns of Glyma08g43541

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g43541 not represented in the dataset	Glyma08g43541 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g43541 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g323300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g43541

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g43541

Limit To All Plant Sequences

>Glyma08g43541.1   sequence type=CDS   gene model=Glyma08g43541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGAAGCACTATGTTCATATATTGAAAAGGATCGACCATTTTTGGGCATTTGTCTTGGACTTCAACTGCTTTTTGAATCCAGCGAGGAGAATGGACCAGTCAAAGGTCTTGGCTTAATACCTGGAACTGTTGGGAGATTTGACTCATCAAATGGTTTTAGAGTACCCCATATTGGCTGGAATGCTTTACAAATCACGAAGGACTTGGGAATTTTGGATGATGTTGGAAATTATCATGTCTATTTTGTGCACTCTTATCGTGCCATGCCTTCAGATGACAACAATGAGTGGATATCCTCTACCTGTGACTACGGTGACAAATTTATAGCATCTATTAGAAGAGGAAATGTGCATGCAGTTCAATTCCACCCAGAGAAGAGTGGAGGTAAAACACAAGGCTATTATTTTTTGGCTTTCTTGGGATGGCACATTCTTGTTCTGATTCCTGAATATAATATTCTCAGATGTTGGTCTCTCTATTTTGAGAAGATTCTTGAATCCGAAATCAAACATGGCAAAGAAGCCTGGGGAAGGCAAAGCTTCAAAACTTGCAAAAAGGTGATTGCTTGTCTTGATGTGAGAACAAATGATAAAGGGGACCTTGTTGTAACCAAAGGAGAATGA

Predicted protein sequences of Glyma08g43541

Limit To All Plant Sequences

>Glyma08g43541.1   sequence type=predicted peptide   gene model=Glyma08g43541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDEALCSYIEKDRPFLGICLGLQLLFESSEENGPVKGLGLIPGTVGRFDSSNGFRVPHIGWNALQITKDLGILDDVGNYHVYFVHSYRAMPSDDNNEWISSTCDYGDKFIASIRRGNVHAVQFHPEKSGGKTQGYYFLAFLGWHILVLIPEYNILRCWSLYFEKILESEIKHGKEAWGRQSFKTCKKVIACLDVRTNDKGDLVVTKGE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain