SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g43451

Feature Type:gene_model
Chromosome:Gm08
Start:43257360
stop:43261986
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g43451
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G55230AT Annotation by Michelle Graham. TAIR10: microtubule-associated proteins 65-1 | chr5:22402716-22405182 FORWARD LENGTH=587 SoyBaseE_val: 1.00E-93ISS
GO:0000272GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide catabolic process SoyBaseN/AISS
GO:0000910GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis SoyBaseN/AISS
GO:0001578GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule bundle formation SoyBaseN/AISS
GO:0005982GO-bp Annotation by Michelle Graham. GO Biological Process: starch metabolic process SoyBaseN/AISS
GO:0007020GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule nucleation SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0030244GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose biosynthetic process SoyBaseN/AISS
GO:0031116GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of microtubule polymerization SoyBaseN/AISS
GO:0043622GO-bp Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization SoyBaseN/AISS
GO:0046785GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule polymerization SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0048528GO-bp Annotation by Michelle Graham. GO Biological Process: post-embryonic root development SoyBaseN/AISS
GO:0051302GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell division SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005819GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spindle SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005874GO-cc Annotation by Michelle Graham. GO Cellular Compartment: microtubule SoyBaseN/AISS
GO:0009524GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast SoyBaseN/AISS
GO:0009574GO-cc Annotation by Michelle Graham. GO Cellular Compartment: preprophase band SoyBaseN/AISS
GO:0010005GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cortical microtubule, transverse to long axis SoyBaseN/AISS
GO:0055028GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cortical microtubule SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008017GO-mf Annotation by Michelle Graham. GO Molecular Function: microtubule binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
PTHR19321Panther PROTEIN REGULATOR OF CYTOKINESIS 1 PRC1-RELATED JGI ISS
PF03999PFAM Microtubule associated protein (MAP65/ASE1 family) JGI ISS
UniRef100_G7K8P9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Microtubule-associated protein MAP65-1a n=1 Tax=Medicago truncatula RepID=G7K8P9_MEDTR SoyBaseE_val: 1.00E-114ISS
UniRef100_UPI0002338C68UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338C68 related cluster n=1 Tax=unknown RepID=UPI0002338C68 SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g43451
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g43451 not represented in the dataset
Glyma08g43451 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g43451
ParalogEvidenceComments
Glyma18g10090 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g43451 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g322200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g43451
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g43451
>Glyma08g43451.1   sequence type=CDS   gene model=Glyma08g43451   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGTGACAAATTCTGAAAATCGTCTTCTTGATGAAAACACCTGTGGTTCATTGTTAGAAAAGTTGCAGGAAATATTGGATGGGAGCAAGAGTTTGGATGTGTACAAAAGAAATGTTGAGCAGGCTTCTAAGTCAAGGGCACTGCTACTTCAATCCTTGTCAGATGCTAAGCTTGAGCTCTCTAGTCTTTTATTGGCTCTTGGTGAAAACAGCTTCATGGGAATGGCTGAAGTGGAAGTTGAAAGGCTTCATCAGCAGAAAGCGAACAGGATGAAAGAAATTGCTTTTAAGAAGCAAGACGAGCTTGAAAAGATATATGCCCATGCGTATATAGCTGCAGCGAAAGAAGAAGCTTTAAGCCAAAAAGAAATATTGGACAAGGTTGAGAAATGGATGTCAGCATGTGAAGAAGAGAGTTGGCTTGAAGACTATAATAGGGGTGAAAACAAGTATAATGCAAGTAAAGGTGCACACTTAAACCTCAAACTTGCAGAGAAAGCAAGTATACTGGTCAACAAAATTCCAGCTTTGGTTGATATATTGGTTGCTAAAACTCGTGTTTGGGAAGAAGCACCTGACATGTCATTCACATATGATGGTGTTCCTCTTCTTGCTATGTTGGATGAATATGCCATGCTCAGGCATGACCATAAAAAGTATCAAGAACAACAAAACACAGATCAGGAACCTGGTTTTGGTTCAAGACCAAGCCCTACAAGGCCACTTGGCAACAAGAAGGTAGTTGGTCTTTGTCCCAACGGAGGCACAAATGGTACTCCCAGACGACTATCTCTTAATGCTCATCAAAATGGAAGCAGGTCCTCAACAAAAGATGGAAAAAAGGATAATACTAGACAAGTTGCTCCTCTTAACTATGTATCGATATCAAAAGAAGATGCTGCTTCTCATGTTTCTGGTACTGAACCAATCCCAACATCACCCTAG
Predicted protein sequences of Glyma08g43451
>Glyma08g43451.1   sequence type=predicted peptide   gene model=Glyma08g43451   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVTNSENRLLDENTCGSLLEKLQEILDGSKSLDVYKRNVEQASKSRALLLQSLSDAKLELSSLLLALGENSFMGMAEVEVERLHQQKANRMKEIAFKKQDELEKIYAHAYIAAAKEEALSQKEILDKVEKWMSACEEESWLEDYNRGENKYNASKGAHLNLKLAEKASILVNKIPALVDILVAKTRVWEEAPDMSFTYDGVPLLAMLDEYAMLRHDHKKYQEQQNTDQEPGFGSRPSPTRPLGNKKVVGLCPNGGTNGTPRRLSLNAHQNGSRSSTKDGKKDNTRQVAPLNYVSISKEDAASHVSGTEPIPTSP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo