Glyma08g43300 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g43300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g43300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g43300

Feature Type:	gene_model
Chromosome:	Gm08
Start:	43138192
stop:	43139880
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g43300

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G50640	AT	Annotation by Michelle Graham. TAIR10: ethylene responsive element binding factor 3 \| chr1:18757602-18758279 REVERSE LENGTH=225	SoyBase	E_val: 2.00E-53	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0010105	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of ethylene mediated signaling pathway	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_I1KYC2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KYC2_SOYBN	SoyBase	E_val: 2.00E-149	ISS
UniRef100_Q5MJ54	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: AT-rich element binding factor 2 n=1 Tax=Pisum sativum RepID=Q5MJ54_PEA	SoyBase	E_val: 1.00E-75	ISS

Expression Patterns of Glyma08g43300

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g43300 not represented in the dataset	Glyma08g43300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g43300

Paralog	Evidence	Comments
Glyma18g10290	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g43300 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g320700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g43300

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g43300

Limit To All Plant Sequences

>Glyma08g43300.1   sequence type=CDS   gene model=Glyma08g43300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTAGGGGTGGAACCGCCGCGGCGGCGGCGGAGGTCGCCGAACCCGGTTTAAGGCCGGTTTATTTCAAAGAACAGCGATATAGGGGCGTCAGAAAAAGACCGTGGGGCCGGTTCGCTGCCGAAATCAGAGACCCTTTGAAGAAAGCCAGGGTTTGGCTCGGAACCTTTGACACCGCCGAGGAGGCGGCGCGTGCCTACGACACGGCGGCGAGAACCCTCCGGGGACCAAAGGCGAAGACCAATTTCCCTCTTTCTCCGCCGTTCTACCATCCCGATCCATTTTCCGATCACCGGCACTTCGCCAACACCGGCGAAGATTTCCACGATCACCGGCGACCAACATCCAGTGGCATGAGCAGCACCGTAGAGTCCTTCAGCGGCCCCCGTGCTGCCGTGCCGGCGACAGCGCCGGTGGCCACCGGCCGGAGATATCCCCGGACGCCACCCGTTATCCCCGAGGACTGCCGCAGCGACTGCGATTCGTCGTCCTCCGTCGTTGACGACGGCGAAGGCGACAACGTGGCGTCGTCGTTCCCGCGAGAACCGTTGCCGTTTGATCTAAACGCGTTGCCGTTAGACGATGCTGACGTGGCAACCGATGATCTGTTCTGCACCGTTCTTTGCCTCTGA

Predicted protein sequences of Glyma08g43300

Limit To All Plant Sequences

>Glyma08g43300.1   sequence type=predicted peptide   gene model=Glyma08g43300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRGGTAAAAAEVAEPGLRPVYFKEQRYRGVRKRPWGRFAAEIRDPLKKARVWLGTFDTAEEAARAYDTAARTLRGPKAKTNFPLSPPFYHPDPFSDHRHFANTGEDFHDHRRPTSSGMSSTVESFSGPRAAVPATAPVATGRRYPRTPPVIPEDCRSDCDSSSSVVDDGEGDNVASSFPREPLPFDLNALPLDDADVATDDLFCTVLCL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain