Glyma08g42861 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g42861

Feature Type:	gene_model
Chromosome:	Gm08
Start:	42823535
stop:	42825469
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g42861

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G54940	AT	Annotation by Michelle Graham. TAIR10: Translation initiation factor SUI1 family protein \| chr5:22308420-22308758 REVERSE LENGTH=112	SoyBase	E_val: 4.00E-67	ISS
GO:0006413	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational initiation	SoyBase	N/A	ISS
GO:0003743	GO-mf	Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity	SoyBase	N/A	ISS
KOG1770	KOG	Translation initiation factor 1 (eIF-1/SUI1)	JGI		ISS
PTHR10388	Panther	TRANSLATION FACTOR SUI1	JGI		ISS
PF01253	PFAM	Translation initiation factor SUI1	JGI		ISS
UniRef100_G7IY05	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Translation factor SUI1-like protein n=1 Tax=Medicago truncatula RepID=G7IY05_MEDTR	SoyBase	E_val: 1.00E-65	ISS
UniRef100_I1KY85	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KY85_SOYBN	SoyBase	E_val: 4.00E-89	ISS

Expression Patterns of Glyma08g42861

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g42861 not represented in the dataset	Glyma08g42861 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g42861

Paralog	Evidence	Comments
Glyma18g11010	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g42861 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g316700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g42861

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g42861

Limit To All Plant Sequences

>Glyma08g42861.1   sequence type=CDS   gene model=Glyma08g42861   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGTAAACCCATCTTCACGTTCTTCATACATATCTTTCTTGTTTGCTTCCCAAGTCTCTCGAAGCATCTTTCTTTCTCTTCCTGCAGAAGCTATCCGTGTTACTTGTTCCCAAGTCTCCAACAAGCAAAGTACATGGTTGATTTGGAAATCCAGGTCCCCAGCGCATTCGACCCGTTTGCCGAGGCGAGAGAATCAGATGCCCCCGGGGCAAAGGAGTATGTGCACATACGAATTCAGCAGAGGAATGGAAAGAAGAGTCTGACAACAGTGCAAGGGCTGAAGAAGGAGTTCAGCTACGAGAAGATCCTCAAGGACCTCAAGAAGGACTTCTGCTGCAACGGGACTGTGGTGCAGGACAAGGAGCTTGGCAAGATTATCCAACTCCAAGGCGACCAGCGCAAGAACGTATCCCATTTCCTCGTTCAGGCCGGTCTTGTCCGGAAGGACCAGGTCAAGATTCATGGTTTTTGA

Predicted protein sequences of Glyma08g42861

Limit To All Plant Sequences

>Glyma08g42861.1   sequence type=predicted peptide   gene model=Glyma08g42861   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRKPIFTFFIHIFLVCFPSLSKHLSFSSCRSYPCYLFPSLQQAKYMVDLEIQVPSAFDPFAEARESDAPGAKEYVHIRIQQRNGKKSLTTVQGLKKEFSYEKILKDLKKDFCCNGTVVQDKELGKIIQLQGDQRKNVSHFLVQAGLVRKDQVKIHGF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain