SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g41813

Feature Type:gene_model
Chromosome:Gm08
Start:41724760
stop:41727538
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g41813
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G35700AT Annotation by Michelle Graham. TAIR10: fimbrin-like protein 2 | chr5:13872833-13876432 REVERSE LENGTH=687 SoyBaseE_val: 7.00E-89ISS
GO:0009846GO-bp Annotation by Michelle Graham. GO Biological Process: pollen germination SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0030036GO-bp Annotation by Michelle Graham. GO Biological Process: actin cytoskeleton organization SoyBaseN/AISS
GO:0030048GO-bp Annotation by Michelle Graham. GO Biological Process: actin filament-based movement SoyBaseN/AISS
GO:0051645GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi localization SoyBaseN/AISS
GO:0051646GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrion localization SoyBaseN/AISS
GO:0060151GO-bp Annotation by Michelle Graham. GO Biological Process: peroxisome localization SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003779GO-mf Annotation by Michelle Graham. GO Molecular Function: actin binding SoyBaseN/AISS
GO:0051015GO-mf Annotation by Michelle Graham. GO Molecular Function: actin filament binding SoyBaseN/AISS
PTHR19961Panther FIMBRIN/PLASTIN JGI ISS
PTHR19961:SF9Panther FIMBRIN-RELATED JGI ISS
PF00307PFAM Calponin homology (CH) domain JGI ISS
UniRef100_G7K4B3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fimbrin-1 n=1 Tax=Medicago truncatula RepID=G7K4B3_MEDTR SoyBaseE_val: 5.00E-92ISS
UniRef100_I1KXX9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KXX9_SOYBN SoyBaseE_val: 3.00E-144ISS

Expression Patterns of Glyma08g41813
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g41813 not represented in the dataset
Glyma08g41813 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g41813 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma08g41813
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g41813
>Glyma08g41813.1   sequence type=CDS   gene model=Glyma08g41813   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCTATGCTGAGATGATGACGGATGATGTACAAACATCTAGAGAAGAGAGATGCTTCCAACTGTGGATCAATAGTCTTGGAATTTCTACACATGTAAATAATATGTTTGAGGATGTCAGAAATGGATGGATACTTTTAGAAGTGGTAGACAACATATTTCCAAGATCAGTTAACTGGAAACATGCAACAAGACCTCCAATTAGAATGCCATTCAGAAAAGTCGAGAACTGCAATCAGGTCATAAAAATTGGTAAACAACTGAGATTCTCACTAGTCAATCTAGCTGGTAATGACATTGTGCAAGAAAATAAGAAGCTCATTCTTGCTTTATTGTGGCAGCTCATGCGATTCACAATGCTTCAACTGTTGAAAATTTTGAGATCTGATTCCCAAGGAAAGGAGATCACTGATGCTGATATCCTGAAATGGGTGAACAGAAAAGTGAAGAGCACTGGCAGAACTTCTCAAATAGAGAGCTTCAAGGCCTGGACAGAGGCATCATCTATTCCAAGAGCACTAGTTTCAATTATTTTAAGATTGCCAAGACTTAAATTTACGATTGTAACCTTGGGAAAAGATGGCTGCATAATGCTTGAGAAATGTGTGGATGATGGTAAAAATACTTTCCCCCCTCTTGTTTTAGCCTTATCAAGTTAA
Predicted protein sequences of Glyma08g41813
>Glyma08g41813.1   sequence type=predicted peptide   gene model=Glyma08g41813   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSYAEMMTDDVQTSREERCFQLWINSLGISTHVNNMFEDVRNGWILLEVVDNIFPRSVNWKHATRPPIRMPFRKVENCNQVIKIGKQLRFSLVNLAGNDIVQENKKLILALLWQLMRFTMLQLLKILRSDSQGKEITDADILKWVNRKVKSTGRTSQIESFKAWTEASSIPRALVSIILRLPRLKFTIVTLGKDGCIMLEKCVDDGKNTFPPLVLALSS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo