Glyma08g41450 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g41450

Feature Type:	gene_model
Chromosome:	Gm08
Start:	41421234
stop:	41425124
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g41450

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G11260	AT	Annotation by Michelle Graham. TAIR10: Basic-leucine zipper (bZIP) transcription factor family protein \| chr5:3593583-3594800 REVERSE LENGTH=168	SoyBase	E_val: 1.00E-54	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006406	GO-bp	Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus	SoyBase	N/A	ISS
GO:0008284	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation	SoyBase	N/A	ISS
GO:0009640	GO-bp	Annotation by Michelle Graham. GO Biological Process: photomorphogenesis	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0009740	GO-bp	Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010017	GO-bp	Annotation by Michelle Graham. GO Biological Process: red or far-red light signaling pathway	SoyBase	N/A	ISS
GO:0010074	GO-bp	Annotation by Michelle Graham. GO Biological Process: maintenance of meristem identity	SoyBase	N/A	ISS
GO:0010099	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of photomorphogenesis	SoyBase	N/A	ISS
GO:0010114	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to red light	SoyBase	N/A	ISS
GO:0010218	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to far red light	SoyBase	N/A	ISS
GO:0010224	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to UV-B	SoyBase	N/A	ISS
GO:0019722	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium-mediated signaling	SoyBase	N/A	ISS
GO:0031539	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of anthocyanin metabolic process	SoyBase	N/A	ISS
GO:0042753	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of circadian rhythm	SoyBase	N/A	ISS
GO:0043687	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-translational protein modification	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0051276	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromosome organization	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003690	GO-mf	Annotation by Michelle Graham. GO Molecular Function: double-stranded DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
PTHR13301	Panther	X-BOX TRANSCRIPTION FACTOR-RELATED	JGI		ISS
PTHR13301:SF21	Panther	CELLULOSE SYNTHASE-RELATED	JGI		ISS
PF00170	PFAM	bZIP transcription factor	JGI		ISS
UniRef100_I1KXV2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KXV2_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q39896	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: TGACG-motif-binding factor n=1 Tax=Glycine max RepID=Q39896_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g41450

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g41450

Paralog	Evidence	Comments
Glyma18g14750	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g41450 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g302500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g41450

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g41450

Limit To All Plant Sequences

>Glyma08g41450.1   sequence type=CDS   gene model=Glyma08g41450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAACGAAGTGGCGGAATGGTAACTGGGTCGCATGAAAGGAACGAACTTGTTAGAGTTAGACACGGCTCTGATAGTAGGTCTAAACCCTTGAAGAATTTGAATGGTCAGAGTTGTCAAATATGTGGTGATACCATTGGATTAACGGCTACTGGTGATGTCTTTGTCGCTTGTCATGAGTGTGGCTTCCCACTTTGTCATTCTTGTTACGAGTATGAGCTGAAACATATGAGCCAGTCTTGTCCCCAGTGCAAGACTGCATTCACAAGTCACCAAGAGGGTGCTGAAGTGGAGGGAGATGATGATGATGAAGACGATGCTGATGATCTAGATAATGAGATCAACTATGGCCAAGGAAACAGTTCCAAGGCGGGGATGCTATGGGAAGAAGATGCTGACCTCTCTTCATCTTCTGGACATGATTCTCAAATACCAAACCCCCATCTAGCAAACGGGCAACCGATGTCTGGTGAGTTTCCATGTGCTACTTCTGATGCTCAATCTATGCAAACTACATCTATAGGTCAATCCGAAAAGGTTCACTCACTTTCATATGCTGATCCAAAGCAACCAGGTCCTGAGAGTGATGAAGAGATAAGAAGAGTGCCAGAGATTGGAGGTGAAAGTGCCGGAACTTCGGCCTCTCAGCCAGATGCCGGTTCAAATGCTGGTACAGAGCGTGTTCAGGGGACAGGGGAGGGTCAGAAGAAGAGAGGGAGAAGCCCAGCTGATAAAGAAAGTAAACGGCTAAAGAGGCTACTGAGGAACCGAGTTTCAGCTCAGCAAGCAAGGGAGAGGAAGAAGGCATACTTGATTGATTTGGAAACAAGAGTCAAAGACTTAGAGAAGAAGAACTCAGAGCTCAAAGAAAGACTTTCCACTTTGCAGAATGAGAACCAAATGCTTAGACAAATATTGAAGAACACAACAGCAAGCAGGAGAGGGAGCAATAATGGTACCAATAATGCTGAGTGA

Predicted protein sequences of Glyma08g41450

Limit To All Plant Sequences

>Glyma08g41450.1   sequence type=predicted peptide   gene model=Glyma08g41450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MERSGGMVTGSHERNELVRVRHGSDSRSKPLKNLNGQSCQICGDTIGLTATGDVFVACHECGFPLCHSCYEYELKHMSQSCPQCKTAFTSHQEGAEVEGDDDDEDDADDLDNEINYGQGNSSKAGMLWEEDADLSSSSGHDSQIPNPHLANGQPMSGEFPCATSDAQSMQTTSIGQSEKVHSLSYADPKQPGPESDEEIRRVPEIGGESAGTSASQPDAGSNAGTERVQGTGEGQKKRGRSPADKESKRLKRLLRNRVSAQQARERKKAYLIDLETRVKDLEKKNSELKERLSTLQNENQMLRQILKNTTASRRGSNNGTNNAE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain