SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g40906

Feature Type:gene_model
Chromosome:Gm08
Start:40834731
stop:40836737
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G35785AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr4:16953404-16955127 REVERSE LENGTH=201 SoyBaseE_val: 2.00E-37ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
PTHR15241Panther TRANSFORMER-2-RELATED JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_G7JYS1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Scaffold attachment factor B1 n=1 Tax=Medicago truncatula RepID=G7JYS1_MEDTR SoyBaseE_val: 2.00E-35ISS
UniRef100_UPI0002338829UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338829 related cluster n=1 Tax=unknown RepID=UPI0002338829 SoyBaseE_val: 7.00E-59ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g40906 not represented in the dataset

Glyma08g40906 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g40906.1   sequence type=CDS   gene model=Glyma08g40906   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAATTTTCATGAAAATCATCGTTGAAATCGAGTATTCAAATACGCTCAATCGAGATCAAGATCTAGGTCTAGGTCGAGATCTAGGCCTAGACAAAGGCCAAGATCCCGTTATAGAAGTCGTGGCAGGTCAAGGTCACCAATTCGTGGAAGGTTGGTCACCAATTCATGGAAGGTCTGAACCTACAAATCCTGGTGACACACTTTATGTAACTGGTCTATCTTCAAGGGTCACCGAAAGAGACCTAAAGAAGCATTTCTCCAAGGAAGGAAAGGTTTGTTCATGTTTTCTTGTGGTGGAGCCTAGTACACGGATTTCTCATGGTTTTGCTTTTGTTACAATGGGGTCCGCTATGGATGCGGAGCACTGTAACAAGTATCTTAACCAATCAGTTTTAGAGGGTAGTTACATCTCTGTTGAGCAGTAA

>Glyma08g40906.1   sequence type=predicted peptide   gene model=Glyma08g40906   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTIFMKIIVEIEYSNTLNRDQDLGLGRDLGLDKGQDPVIEVVAGQGHQFVEGWSPIHGRSEPTNPGDTLYVTGLSSRVTERDLKKHFSKEGKVCSCFLVVEPSTRISHGFAFVTMGSAMDAEHCNKYLNQSVLEGSYISVEQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo