SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g39731): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g39731): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g39731

Feature Type:gene_model
Chromosome:Gm08
Start:39241707
stop:39252299
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G60220AT Annotation by Michelle Graham. TAIR10: UB-like protease 1D | chr1:22208332-22211910 FORWARD LENGTH=584 SoyBaseE_val: 2.00E-109ISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0016926GO-bp Annotation by Michelle Graham. GO Biological Process: protein desumoylation SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0050665GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008234GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity SoyBaseN/AISS
GO:0016929GO-mf Annotation by Michelle Graham. GO Molecular Function: SUMO-specific protease activity SoyBaseN/AISS
KOG3246 KOG Sentrin-specific cysteine protease (Ulp1 family) JGI ISS
PTHR12606Panther SENTRIN/SUMO-SPECIFIC PROTEASE JGI ISS
PF02902PFAM Ulp1 protease family, C-terminal catalytic domain JGI ISS
UniRef100_B9SH87UniRef Annotation by Michelle Graham. Most informative UniRef hit: Sentrin/sumo-specific protease, putative n=1 Tax=Ricinus communis RepID=B9SH87_RICCO SoyBaseE_val: 2.00E-130ISS
UniRef100_UPI000233EAF5UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EAF5 related cluster n=1 Tax=unknown RepID=UPI000233EAF5 SoyBaseE_val: 5.00E-173ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g39731 not represented in the dataset

Glyma08g39731 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma18g18951 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g39731.1   sequence type=CDS   gene model=Glyma08g39731   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAACAACAGCGGCAACAACAAAAACCAAAGAGTCCTCTCCCCATTGACTGGAGCCGGCAGTTCCAAAGTGACTCGCCGCCGCGCGACTACGACATCCTGCCGGCCTCCTCCTCCGCCGATCAGGACGACCTCTCCGCTATTCCCGATCACAAGCTCAGGGAGTCGATTCAGAGCAAGAAGAGAACCCTCGACGTTACCGGCAAGAATTTGCCCGACAAAGGCACCAAGCTTCGCGCTACCATCGACCGCTACCAGCAGGAACTTACCCACCGGGAGCAACAAAAGCGTCTTCGCCAGGAAGATGACAAGGACCGGAAGCCGCAACCCGGACAAGCTTCAAGCACAGATGCTGTTACTGAGGGTGTGTCTAATGACTTGAGAGAAGAGAATTTGTTGTCTCAAGCTCAGTCACAATCCACTTTTACATCTTGCTTTGTTAAACAAATGGAAGATAATGGTCTGCCCATTGTTCTGGATGTTGATGACGATGATGGCGGCGACAACAACGACGAATACGACGACGATGAAGCTCATATTGTGGAGAAAACAGAAAACAAATTTCCTGAATACCTGAAAGAAGCTAAGATCTATTTTCCATCAAGAGATGATCCAGAGTGCGTTGAAATTTGTTTCACAGACACAAATTGCCTTGCCCCGGAAGGCTATTTAACATCAACTATTATGAACTTCTACATTCAATATTTGCAGCAACAAGCATTGTTGACAAATAGATCGTTATCTGCCTACCATTTTTTCAATACATATTTCTACAAGAAGCTTAAAGAAGCTGTTTCCTACAAGATCTTTGCAAAGTTCAGAAGATGGTGGAAAGGTGTAAATATTTTTCAGAAGGCTTATGTTTTGATTCCAATACACGAGGACCTTCATTGGAGCTTGATCATTATTTGCATCCCAGACAAAGAAGATGAATCGGGGCCAATCATACTTCATTTGGATTCTTTGGGTCTTCACTCTAGTAAATCAGTTTTTGATAATATTAAAAGCTATTTGATTGAAGAAAAGAACTACATGGATCGAGAAGACATGGCTTCAGATGTTTCAATTGCGGATAGAATATGGAAGTGCCTTCCTCGTAGAATCGAATCTCAAATCATTCAGGTTCCCCAACAGAAGAATGACTATGACTGTGGTCTTTTTGTATTGTACTTCATTGAACGTTTCATGGAGGAGGCACCGGAAAGACTGAAAATGAAAGATTTAGATATGTTTGGAAGGCGATGGTTCAAACCTCAAGAGGCGTCCAATTTGAGAGTGAAAATCCGGATTCTCTTACTGGCCCTGCAACTGATTGTGTTGAGACCACCGAGGATTCTGTGA

>Glyma08g39731.1   sequence type=predicted peptide   gene model=Glyma08g39731   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEQQRQQQKPKSPLPIDWSRQFQSDSPPRDYDILPASSSADQDDLSAIPDHKLRESIQSKKRTLDVTGKNLPDKGTKLRATIDRYQQELTHREQQKRLRQEDDKDRKPQPGQASSTDAVTEGVSNDLREENLLSQAQSQSTFTSCFVKQMEDNGLPIVLDVDDDDGGDNNDEYDDDEAHIVEKTENKFPEYLKEAKIYFPSRDDPECVEICFTDTNCLAPEGYLTSTIMNFYIQYLQQQALLTNRSLSAYHFFNTYFYKKLKEAVSYKIFAKFRRWWKGVNIFQKAYVLIPIHEDLHWSLIIICIPDKEDESGPIILHLDSLGLHSSKSVFDNIKSYLIEEKNYMDREDMASDVSIADRIWKCLPRRIESQIIQVPQQKNDYDCGLFVLYFIERFMEEAPERLKMKDLDMFGRRWFKPQEASNLRVKIRILLLALQLIVLRPPRIL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo