SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g39411

Feature Type:gene_model
Chromosome:Gm08
Start:38951750
stop:38958682
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g39411
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G60810AT Annotation by Michelle Graham. TAIR10: unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). | chr3:22470579-22471756 FORWARD LENGTH=209 SoyBaseE_val: 2.00E-76ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF07386PFAM Protein of unknown function (DUF1499) JGI ISS
UniRef100_Q84M78UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Oryza sativa Japonica Group RepID=Q84M78_ORYSJ SoyBaseE_val: 5.00E-64ISS
UniRef100_UPI000233853BUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233853B related cluster n=1 Tax=unknown RepID=UPI000233853B SoyBaseE_val: 1.00E-142ISS

Expression Patterns of Glyma08g39411
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g39411 not represented in the dataset
Glyma08g39411 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g39411 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g286100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g39411
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g39411
>Glyma08g39411.1   sequence type=CDS   gene model=Glyma08g39411   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTTCGTTCTCCTTCTGCACCCTCAAGTTTCGCACCAAACCCAACGATAGTAGAAGCAGTGCTTCCTCTCTTCCCCGTATTCTATTCTGTCACAACCTCCACGATGACATTCACACACCCACTGACCAAATCAACCGAAGTGGGAAAAAACCTGATTATCTTGGAGTGCAGAAAAACCCACCAGCTTTAGCTCTGTGTCCGGTAACTAGGAACTGCGTATCAACCTCTGAGAATATCAGTGATCGCACTCATTATGCTCCTCTTTGGAACTACAATCCTGAAGGTAGGAAAAACCCTGTGAGCAGAGAAGAGGCAATGGAGGAACTGATAGACGTGATAGAATCAACAACACCAGACAAATTTACACCACGAATAGTTGAAAGGAAGGAAGACTATATTCATGTGGAGTACCAAAGCTCAATCTTGGGGTTTGTGCATGATGTTGAGTTCTGGTTTCCACTGGGTAAGGGTTCTACTGTGGAGTATCGATCTGCATCTCGGTTGGGGAACTTTGATTTTGATGTGAATAAGAAAAGAATAAAGGCACTGCGACAAGAGTTGGAGAAGAAAGGATGGGAATCTGAAGACATAATATGA
Predicted protein sequences of Glyma08g39411
>Glyma08g39411.1   sequence type=predicted peptide   gene model=Glyma08g39411   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSFSFCTLKFRTKPNDSRSSASSLPRILFCHNLHDDIHTPTDQINRSGKKPDYLGVQKNPPALALCPVTRNCVSTSENISDRTHYAPLWNYNPEGRKNPVSREEAMEELIDVIESTTPDKFTPRIVERKEDYIHVEYQSSILGFVHDVEFWFPLGKGSTVEYRSASRLGNFDFDVNKKRIKALRQELEKKGWESEDII*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo