SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g33600

Feature Type:gene_model
Chromosome:Gm08
Start:30282964
stop:30285570
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G09880AT Annotation by Michelle Graham. TAIR10: Splicing factor, CC1-like | chr5:3081646-3085179 REVERSE LENGTH=527 SoyBaseE_val: 1.00E-32ISS
GO:0006397GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA processing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
PTHR24012Panther FAMILY NOT NAMED JGI ISS
PTHR24012:SF293Panther JGI ISS
UniRef100_G7LC87UniRef Annotation by Michelle Graham. Most informative UniRef hit: RNA-binding protein n=3 Tax=Medicago truncatula RepID=G7LC87_MEDTR SoyBaseE_val: 4.00E-39ISS
UniRef100_I1KTD7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KTD7_SOYBN SoyBaseE_val: 3.00E-42ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g33600.1   sequence type=CDS   gene model=Glyma08g33600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGCTAAAAGCAACAGAGAGAGATGTGTATGAGTTCTTTTCAAAAGCTGGCAAGATTATTATTGGAGTTGGTTCTGAAAACTTGATGCAAGTTCTTGATGAGGATGCAGTGCCAATGGCTATTGCTCTCTCTGGCCCACTTCTTCTTGGACAACCTATAATGGTGAAACCTTCTGAAGCTGAAAAGAACCTTGTTCAATCTAATGCTTCTGGTGGAGCAGCCAGTGTAACTGGCCCCTATGGAGCTGTGGACCGAAAATTGTATGTGGGGAATCTTCACTTCAACATGATTGAG

>Glyma08g33600.1   sequence type=predicted peptide   gene model=Glyma08g33600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPLKATERDVYEFFSKAGKIIIGVGSENLMQVLDEDAVPMAIALSGPLLLGQPIMVKPSEAEKNLVQSNASGGAASVTGPYGAVDRKLYVGNLHFNMIE







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo