Report for Sequence Feature Glyma08g33600
Feature Type: gene_model
Chromosome: Gm08
Start: 30282964
stop: 30285570
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g33600
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G09880 AT
Annotation by Michelle Graham. TAIR10: Splicing factor, CC1-like | chr5:3081646-3085179 REVERSE LENGTH=527
SoyBase E_val: 1.00E-32 ISS
GO:0006397 GO-bp
Annotation by Michelle Graham. GO Biological Process: mRNA processing
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0003676 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding
SoyBase N/A ISS
GO:0003723 GO-mf
Annotation by Michelle Graham. GO Molecular Function: RNA binding
SoyBase N/A ISS
PTHR24012 Panther
FAMILY NOT NAMED
JGI ISS
PTHR24012:SF293 Panther
JGI ISS
UniRef100_G7LC87 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RNA-binding protein n=3 Tax=Medicago truncatula RepID=G7LC87_MEDTR
SoyBase E_val: 4.00E-39 ISS
UniRef100_I1KTD7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KTD7_SOYBN
SoyBase E_val: 3.00E-42 ISS
Expression Patterns of Glyma08g33600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma08g33600 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
References for Glyma08g33600
Coding sequences of Glyma08g33600
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g33600.1 sequence type=CDS gene model=Glyma08g33600 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCCGCTAAAAGCAACAGAGAGAGATGTGTATGAGTTCTTTTCAAAAGCTGGCAAGATTATTATTGGAGTTGGTTCTGAAAACTTGATGCAAGTTCTTGATGAGGATGCAGTGCCAATGGCTATTGCTCTCTCTGGCCCACTTCTTCTTGGACAACCTATAATGGTGAAACCTTCTGAAGCTGAAAAGAACCTTGTTCAATCTAATGCTTCTGGTGGAGCAGCCAGTGTAACTGGCCCCTATGGAGCTGTGGACCGAAAATTGTATGTGGGGAATCTTCACTTCAACATGATTGAG
Predicted protein sequences of Glyma08g33600
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g33600.1 sequence type=predicted peptide gene model=Glyma08g33600 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MPLKATERDVYEFFSKAGKIIIGVGSENLMQVLDEDAVPMAIALSGPLLLGQPIMVKPSEAEKNLVQSNASGGAASVTGPYGAVDRKLYVGNLHFNMIE