SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g31614): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g31614): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g31614

Feature Type:gene_model
Chromosome:Gm08
Start:27535299
stop:27537148
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G54850AT Annotation by Michelle Graham. TAIR10: plant U-box 14 | chr3:20321524-20323848 FORWARD LENGTH=632 SoyBaseE_val: 1.00E-60ISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0000151GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ubiquitin ligase complex SoyBaseN/AISS
GO:0005871GO-cc Annotation by Michelle Graham. GO Cellular Compartment: kinesin complex SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0019894GO-mf Annotation by Michelle Graham. GO Molecular Function: kinesin binding SoyBaseN/AISS
GO:0070696GO-mf Annotation by Michelle Graham. GO Molecular Function: transmembrane receptor protein serine/threonine kinase binding SoyBaseN/AISS
PTHR23315Panther BETA CATENIN-RELATED ARMADILLO REPEAT-CONTAINING JGI ISS
PTHR23315:SF31Panther OS06G0102700 PROTEIN JGI ISS
UniRef100_B9SUD5UniRef Annotation by Michelle Graham. Most informative UniRef hit: E3 ubiquitin ligase PUB14, putative n=1 Tax=Ricinus communis RepID=B9SUD5_RICCO SoyBaseE_val: 3.00E-71ISS
UniRef100_UPI0002339704UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339704 related cluster n=1 Tax=unknown RepID=UPI0002339704 SoyBaseE_val: 5.00E-100ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g31614 not represented in the dataset

Glyma08g31614 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g262500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g31614.1   sequence type=CDS   gene model=Glyma08g31614   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTTCTGCAATGTACCTCTCAACAATAGATGCTTCTGGACGATATAGATTCTTTGTATACCCTTTTAAGATCTTCATGTATTGCTCAACCGGTCTTTCAGAGGATGCTGCTACTGCTCTAATAAAGTTACTTTGTGAAGGTACTCCTACAGGTAAGAAGGATGCTGCTACTGCTATCTTCAACCTATCTATTTATCAGGGAAATAAACCAAGAGCTGTAAAAGCTGGTATAATAGCCCTACTGATACAATTTTTGAAGGATGCTGGAGGTGGAATTGTAGATGAAGTAGTAGCTATTATGGAAATCCTTGCAAGCCACCATGAAGGCAGGGTAGCGATCGGTCAGGCCAAGTCAATTCATATTCTTGTTGAGGTTATACGAACCGGCTCTCCACGCAATCGAGAGAATGCTGCTGCTGTCTTGTGGCCACTATGCACCGAAGATCCACTACAATTAAAACTAGCGAAAGAACATGGTGCAGAAGCAGCATTGCAGGAGTTGTCAGAAAATGGAACTGATAGAGCTAAGATAAAAGCTGGAAGCATATTGGAACTCTTGCAGCGAATGGAAGGGGTTGATAATTTGCAGAGTTCATAG

>Glyma08g31614.1   sequence type=predicted peptide   gene model=Glyma08g31614   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSAMYLSTIDASGRYRFFVYPFKIFMYCSTGLSEDAATALIKLLCEGTPTGKKDAATAIFNLSIYQGNKPRAVKAGIIALLIQFLKDAGGGIVDEVVAIMEILASHHEGRVAIGQAKSIHILVEVIRTGSPRNRENAAAVLWPLCTEDPLQLKLAKEHGAEAALQELSENGTDRAKIKAGSILELLQRMEGVDNLQSS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo