SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g27720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g27720): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g27720

Feature Type:gene_model
Chromosome:Gm08
Start:22045466
stop:22048525
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g27720
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G38900AT Annotation by Michelle Graham. TAIR10: Thioredoxin superfamily protein | chr5:15573745-15574945 REVERSE LENGTH=217 SoyBaseE_val: 2.00E-100ISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009817GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus, incompatible interaction SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0015035GO-mf Annotation by Michelle Graham. GO Molecular Function: protein disulfide oxidoreductase activity SoyBaseN/AISS
PF01323PFAM DSBA-like thioredoxin domain JGI ISS
UniRef100_G7KR18UniRef Annotation by Michelle Graham. Most informative UniRef hit: DSBA-like thioredoxin domain containing protein n=3 Tax=Medicago truncatula RepID=G7KR18_MEDTR SoyBaseE_val: 9.00E-131ISS
UniRef100_I1KWJ3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KWJ3_SOYBN SoyBaseE_val: 4.00E-156ISS

Expression Patterns of Glyma08g27720
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g27720 not represented in the dataset
Glyma08g27720 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g27720
ParalogEvidenceComments
Glyma18g50940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g27720 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g251200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g27720
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g27720
>Glyma08g27720.1   sequence type=CDS   gene model=Glyma08g27720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTGGGATTTCGGAAAAGAAACTCATCAGAATCGATGCTAGTGCTGATACTGTGTGCCCATGGTGCTTTGTTGGCAAAAAGAATCTAGACAAGGCCATAGCTTCCTCCAAGGATAAATACAACTTTGAGATAATATGGCATCCCTTTCAACTTAACCCTGATGCCCCTAAAGAAGGCATTGACAAGAGGGAGTTTTACAGAAGTAAGTTTGGATCACAATCAGAACGGATGGAAGCTCGGATGTCAGAGGTGTTCAAGAATGTTGGTCTGGAATATAGCTTGTCTGGACTCACGGGAAACACTATTGACAGCCACAGGCTTATATATTTTGCTAGACAGCAGGGTCTTGACAAGCAACATGATCTAGTTGAAGAACTGAACATTGGCTATTTCACACAGGGAAAATACATCGGTGACCATAAGTTTCTTCTGGAATCTGCTGCAAAGGTTGGTATAGAAGGAGCAGAAGAGTTTCTTAAGGACCCCAACAATGGTTTGAAGGAGGTTGAGGAGGAACTAAAAAATAATTCAGGAAACATTTCAGGGGTTCCATATTACGTGATTAATGGGACTCACAAGTTGAGCGGTGGACAAGCCCCTGAAGTTTTCTTGAGAGCTTTTCAAGTTGCTACAACTTGA
Predicted protein sequences of Glyma08g27720
>Glyma08g27720.1   sequence type=predicted peptide   gene model=Glyma08g27720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGISEKKLIRIDASADTVCPWCFVGKKNLDKAIASSKDKYNFEIIWHPFQLNPDAPKEGIDKREFYRSKFGSQSERMEARMSEVFKNVGLEYSLSGLTGNTIDSHRLIYFARQQGLDKQHDLVEELNIGYFTQGKYIGDHKFLLESAAKVGIEGAEEFLKDPNNGLKEVEEELKNNSGNISGVPYYVINGTHKLSGGQAPEVFLRAFQVATT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo