SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g27201

Feature Type:gene_model
Chromosome:Gm08
Start:21508561
stop:21510117
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G26190AT Annotation by Michelle Graham. TAIR10: Haloacid dehalogenase-like hydrolase (HAD) superfamily protein | chr4:13262473-13266282 REVERSE LENGTH=1057 SoyBaseE_val: 2.00E-13ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF03031PFAM NLI interacting factor-like phosphatase JGI ISS
UniRef100_F4JU71UniRef Annotation by Michelle Graham. Most informative UniRef hit: Haloacid dehalogenase-like hydrolase domain-containing protein n=1 Tax=Arabidopsis thaliana RepID=F4JU71_ARATH SoyBaseE_val: 1.00E-10ISS
UniRef100_UPI000233ECBBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233ECBB related cluster n=1 Tax=unknown RepID=UPI000233ECBB SoyBaseE_val: 1.00E-57ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g27201 not represented in the dataset

Glyma08g27201 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma18g50410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g247600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g27201.1   sequence type=CDS   gene model=Glyma08g27201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAACCCCGTAGAGAGCGAAGAAAAAAATTAGTTCGTCGCATACCAAAGGAAGGCATAAAAAATACCACGAATACTGAGTCAGCTGTAGTAGATGAAACAAATAGTGATAAACAAGTTTCTTGTAGTAATGAGTTGCGGAAATTATCCGGTTCTAGTATAAATACAGATAGGCAAAAAACTTTGCGAATTTCTACAGTTAGACCGTCAATTTTGTGTTTAAAGAAGAAGCTTATTGTTCTTGATTTAAATGGGCTGCTTGTGGACATGGTTTCTCCCCCTCCAAAGTACTGTAAAGCAGATGCAATCATAGGAAGGAAAGCAATGTTCAAGAGACCTTTTTATCTTGAGTTTCTGAACTTCTGCTTTGAGAAATTTGAAGTGGCTGTATGGTCTTCAAGAACCTTCCAAGGGTACGCTGTGCTTCTCCAACGTGTCCAAGGTGCAAACACCAAGCAGCTTTCTCACTTTTGCAGTACTTCAAGACAATTGCTCCATCATTGTTGA

>Glyma08g27201.1   sequence type=predicted peptide   gene model=Glyma08g27201   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEPRRERRKKLVRRIPKEGIKNTTNTESAVVDETNSDKQVSCSNELRKLSGSSINTDRQKTLRISTVRPSILCLKKKLIVLDLNGLLVDMVSPPPKYCKADAIIGRKAMFKRPFYLEFLNFCFEKFEVAVWSSRTFQGYAVLLQRVQGANTKQLSHFCSTSRQLLHHC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo