Glyma08g26490 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g26490

Feature Type:	gene_model
Chromosome:	Gm08
Start:	20827472
stop:	20828355
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g26490

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G61220	AT	Annotation by Michelle Graham. TAIR10: LYR family of Fe/S cluster biogenesis protein \| chr5:24626057-24626320 REVERSE LENGTH=87	SoyBase	E_val: 6.00E-27	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
KOG3801	KOG	Uncharacterized conserved protein BCN92	JGI		ISS
PTHR13166	Panther	PROTEIN C6ORF149	JGI		ISS
PF05347	PFAM	Complex 1 protein (LYR family)	JGI		ISS
UniRef100_H2CLX5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Catalytic/ oxidoreductase n=1 Tax=Allium sativum RepID=H2CLX5_ALLSA	SoyBase	E_val: 3.00E-31	ISS
UniRef100_I1KWC7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KWC7_SOYBN	SoyBase	E_val: 8.00E-63	ISS

Expression Patterns of Glyma08g26490

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g26490

Paralog	Evidence	Comments
Glyma18g49970	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g26490 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g242600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g26490

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g26490

Limit To All Plant Sequences

>Glyma08g26490.2   sequence type=CDS   gene model=Glyma08g26490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTTTTCTTGATCTTCCCTCAATTCACATTTCTTCTCTGACGCTGTATTCTGTTCTGTACCTGGAGGGAGCCATGAGTGCAGCTGCGTCATCCTCCGCTACTCCTTCCGCTGCCCAAGTCCTCTCCCTCTTCCGATCCCTCCTCCGCGCCGCGCGCGAGTTCCCCGATTACAATATCAGGGAGTACACCAAACGACGCACCATCGATTCGTTTCGCCACAACGCCACTCTCTCCGACCCGTCTCAAATTTCCACCGCCTTCGCCCACGGCAAGTCACAGCTCGCCGTCGTTAAACGACAGGCCGTCGTCTACTCCCTCTACGATTCTCCGCTCCGCAGCGTCATGGAACTCCAACAAGTCCCCTTCTAA

Predicted protein sequences of Glyma08g26490

Limit To All Plant Sequences

>Glyma08g26490.2   sequence type=predicted peptide   gene model=Glyma08g26490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIFLDLPSIHISSLTLYSVLYLEGAMSAAASSSATPSAAQVLSLFRSLLRAAREFPDYNIREYTKRRTIDSFRHNATLSDPSQISTAFAHGKSQLAVVKRQAVVYSLYDSPLRSVMELQQVPF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain