Glyma08g25650 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g25650

Feature Type:	gene_model
Chromosome:	Gm08
Start:	20022817
stop:	20024221
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g25650

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G12955	AT	Annotation by Michelle Graham. TAIR10: SAUR-like auxin-responsive protein family \| chr3:4135659-4136078 REVERSE LENGTH=139	SoyBase	E_val: 1.00E-36	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF02519	PFAM	Auxin responsive protein	JGI		ISS
UniRef100_B9GK00	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: SAUR family protein n=1 Tax=Populus trichocarpa RepID=B9GK00_POPTR	SoyBase	E_val: 7.00E-52	ISS
UniRef100_C6T0R1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T0R1_SOYBN	SoyBase	E_val: 1.00E-88	ISS

Expression Patterns of Glyma08g25650

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g25650 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g236300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g25650

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g25650

Limit To All Plant Sequences

>Glyma08g25650.1   sequence type=CDS   gene model=Glyma08g25650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAGATCAATCTATTACTCCGAAAATGCAAGAGTTTGTCAAGGCAGCTAGGAAGATCTTCATCTTATAGCAGCCTGAGGTCAAAATCCACAAAAGAAGACATATGGGGGGGTAGACATGGAATGCAAGAAGATGAAAATTGTGAAACTATATTTGTTGGCAGCACAAGGAAACGGTACATAATCAGCAAAAAGTATCTGAACCATCCTCTTCTGAATGCACTAATCAACAAGTCAAAGCAAATTAAGAAGGACAGTGATGAAAGTAGTGTGTTGGTGGTCAACTGTGAGGTGGTTCTCTTTGATCATCTATTGTGGATGCTAGAAAATGCAGATCCCAAGTTTAGTTCTGAGTCTTTGGAGGAATTGGCTGAACTCTATGTGTTTTGA

Predicted protein sequences of Glyma08g25650

Limit To All Plant Sequences

>Glyma08g25650.1   sequence type=predicted peptide   gene model=Glyma08g25650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKINLLLRKCKSLSRQLGRSSSYSSLRSKSTKEDIWGGRHGMQEDENCETIFVGSTRKRYIISKKYLNHPLLNALINKSKQIKKDSDESSVLVVNCEVVLFDHLLWMLENADPKFSSESLEELAELYVF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain