SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g25610): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g25610): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g25610

Feature Type:gene_model
Chromosome:Gm08
Start:19988220
stop:19992229
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g25610
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G53670AT Annotation by Michelle Graham. TAIR10: methionine sulfoxide reductase B 1 | chr1:20036687-20038074 FORWARD LENGTH=202 SoyBaseE_val: 7.00E-80ISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0008113GO-mf Annotation by Michelle Graham. GO Molecular Function: peptide-methionine (S)-S-oxide reductase activity SoyBaseN/AISS
GO:0033743GO-mf Annotation by Michelle Graham. GO Molecular Function: peptide-methionine (R)-S-oxide reductase activity SoyBaseN/AISS
KOG0856 KOG Predicted pilin-like transcription factor JGI ISS
PTHR10173Panther METHIONINE SULFOXIDE REDUCTASE JGI ISS
PTHR10173:SF0Panther PEPTIDE METHIONINE SULFOXIDE REDUCTASE JGI ISS
PF01641PFAM SelR domain JGI ISS
UniRef100_A7U630UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chloroplast methionine sulfoxide reductase B1 (Fragment) n=1 Tax=Nicotiana tabacum RepID=A7U630_TOBAC SoyBaseE_val: 3.00E-92ISS
UniRef100_C6TFD8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TFD8_SOYBN SoyBaseE_val: 2.00E-149ISS

Expression Patterns of Glyma08g25610
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g25610 not represented in the dataset
Glyma08g25610 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g25610 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g236000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g25610
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g25610
>Glyma08g25610.1   sequence type=CDS   gene model=Glyma08g25610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTCAAAGTTTGAGTTTACCACCAACACATATTCCTTACAATAGGATAATTGGGAAGCTTGATTCCAAGTTTTTGTTGTGGCCTTCTTGTGCTCATATCAAACCCAGAAGAATTTCTACCTCAATTCGGGCAATGGGTTCCTCCGCTTCTTCCCACTCCCAGTCACAATATGCAGACAGCGTTGAATCTGAAGCAGGAGCTGATACTATTGACTATAAATCTTTAACCGATGAAGAGTGGAAGAAGCGGCTCACAAATGAACAGTTCTATATTACTCGTCAGAAGGGAACTGAAAGAGCTTTCACTGGGGAGTACTGGAATACTAAAACCCCGGGGATTTACCATTGCATATGTTGCGACACACCTTTATTCGAATCATCTACTAAGTTCAATAGTGGAACTGGGTGGCCATCCTATTACCAGACAATTGGGAAAAATGTGAAATCAAAGTTGGATTTGTCAATTATTTTCATGCCGCGCCAGGAGGTTCTCTGTGCTGTTTGTGATGCTCATCTTGGACATGTGTTTGACGATGGTCCTCCACCCACGGGAAAACGTTTCTGTATCAATAGTGCTGCCCTTAAGCTCAAACCAAAGCAGTAG
Predicted protein sequences of Glyma08g25610
>Glyma08g25610.1   sequence type=predicted peptide   gene model=Glyma08g25610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASQSLSLPPTHIPYNRIIGKLDSKFLLWPSCAHIKPRRISTSIRAMGSSASSHSQSQYADSVESEAGADTIDYKSLTDEEWKKRLTNEQFYITRQKGTERAFTGEYWNTKTPGIYHCICCDTPLFESSTKFNSGTGWPSYYQTIGKNVKSKLDLSIIFMPRQEVLCAVCDAHLGHVFDDGPPPTGKRFCINSAALKLKPKQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo