SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g25170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g25170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g25170

Feature Type:gene_model
Chromosome:Gm08
Start:19427609
stop:19431165
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G79340AT Annotation by Michelle Graham. TAIR10: metacaspase 4 | chr1:29842849-29844368 FORWARD LENGTH=418 SoyBaseE_val: 0ISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0016540GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoprocessing SoyBaseN/AISS
GO:0043068GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of programmed cell death SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0004197GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type endopeptidase activity SoyBaseN/AISS
GO:0008234GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
KOG1546 KOG Metacaspase involved in regulation of apoptosis JGI ISS
PF00656PFAM Caspase domain JGI ISS
UniRef100_B9RYK8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Caspase, putative n=1 Tax=Ricinus communis RepID=B9RYK8_RICCO SoyBaseE_val: 0ISS
UniRef100_I1KW34UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KW34_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g25170 not represented in the dataset

Glyma08g25170 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g233500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g25170.1   sequence type=CDS   gene model=Glyma08g25170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAAAAAAGCCGTTTTGATCGGAATAAACTACCCGGGCACGAAGGCGGAGCTGAAAGGATGCATAAACGACGTGAGGAGGATGCAACGCTGCCTCATCGATCGATACGGTTTCTCCGAAGACGACATCACCGTTTTGATCGACACGGACGAGTCCTACACGGAGCCCACGGGGAAGAACATCCGGTCAGCGTTGACCAGGCTGGTCCGATCGGCGAAGCCAGGGGACATTCTGTTCGTCCATTACAGCGGACACGGCACGCGCCTCCCCGCGGAAACCGGAGAGGATGATGACACTGGCTTTGATGAATGCATTGTTCCGTCTGACATGAACCTCATCACTGATGATGATTTCAGGGAATTTGTTGATGGGGTGCCTAGAGGTTGCACGATCACAATTGTGTCTGATTCTTGCCACAGTGGTGGCCTACTTGAAGAAGCTAAGGAGCAGATAGGAGAGAGCACAAAGGGAGAGGAGGAACAATCTGGCTCTGGCTTTGGATTTTCAAGTTTTCTACACCGGACCGTGGAAGATGCCATCGAGTCTCGCGGATTCCATATCCCTTCAGCATTGCGCCACAACAGAGGCAGGGATGATGATGTTGATGAAGCTCAAGATAGGGAAATTGAACTTCCAAATGGGGGCTATGTAAAGAATAGGTCTTTGCCCCTTTCAACCCTGATTGATATACTCAAGCAGAAAACTGGAAAAGATGATATAGATGTTGGGAAACTGAGACCTACACTCTTTGATGTTTTTGGAGAAGATGCTAGTCCTAAAGTGAAGAAGTTCATGAATGTTATTTTTAACAAACTCCAACATGGAAGTGGTGAAAGTGGGGGTGGAATATTGGGGTTGGTAGGTGGTCTTGCACAAGAGTTTCTCAAGCAAAAGCTTGATGACAATGATGAGGGATATGCAAAGCCTGCATTGGAGACAAAAGTGGAAAGTAAGCAAGAGGCATATGCTGGACCAACCAAACGTGGCCTTCCGGATGGTGGGATATTGATGAGTGGATGTCAGACCGACCAAACTTCTGCCGATGCAAGTCCTGCAGGAAGCGCTGCCAGTGCTTATGGAGCTTTTAGCAATGCAATACAGGCTATAATTGAGGAGACTGATGGTGCAATCACAAACCAAGAACTTGTTCAAAGGGCAAGAGAGAAGCTGAAGAACTCCGGTTTCACTCAAAAACCGGGACTCTATTGCAGTGATCATCATGTTGATGCTCCTTTTGTGTGTTGA

>Glyma08g25170.1   sequence type=predicted peptide   gene model=Glyma08g25170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKKAVLIGINYPGTKAELKGCINDVRRMQRCLIDRYGFSEDDITVLIDTDESYTEPTGKNIRSALTRLVRSAKPGDILFVHYSGHGTRLPAETGEDDDTGFDECIVPSDMNLITDDDFREFVDGVPRGCTITIVSDSCHSGGLLEEAKEQIGESTKGEEEQSGSGFGFSSFLHRTVEDAIESRGFHIPSALRHNRGRDDDVDEAQDREIELPNGGYVKNRSLPLSTLIDILKQKTGKDDIDVGKLRPTLFDVFGEDASPKVKKFMNVIFNKLQHGSGESGGGILGLVGGLAQEFLKQKLDDNDEGYAKPALETKVESKQEAYAGPTKRGLPDGGILMSGCQTDQTSADASPAGSAASAYGAFSNAIQAIIEETDGAITNQELVQRAREKLKNSGFTQKPGLYCSDHHVDAPFVC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo