Report for Sequence Feature Glyma08g24320
Feature Type: gene_model
Chromosome: Gm08
Start: 18508831
stop: 18509842
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g24320
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G61750 AT
Annotation by Michelle Graham. TAIR10: RmlC-like cupins superfamily protein | chr5:24812804-24813436 REVERSE LENGTH=210
SoyBase E_val: 2.00E-64 ISS
GO:0005576 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extracellular region
SoyBase N/A ISS
GO:0048046 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: apoplast
SoyBase N/A ISS
GO:0030145 GO-mf
Annotation by Michelle Graham. GO Molecular Function: manganese ion binding
SoyBase N/A ISS
GO:0045735 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity
SoyBase N/A ISS
PF00190 PFAM
Cupin
JGI ISS
UniRef100_C6T1Q5 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 7 n=1 Tax=Glycine max RepID=C6T1Q5_SOYBN
SoyBase E_val: 2.00E-150 ISS
UniRef100_C6T1Q5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Germin-like protein 7 n=1 Tax=Glycine max RepID=C6T1Q5_SOYBN
SoyBase E_val: 2.00E-150 ISS
Expression Patterns of Glyma08g24320
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma08g24320
Paralog Evidence Comments
Glyma15g35130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g24320 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g226800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g24320
Coding sequences of Glyma08g24320
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g24320.1 sequence type=CDS gene model=Glyma08g24320 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAAACCCTTTGCTCCCTTTTTCTTTATGTTGTTGTTCTTGGAGGCTTTTTCCAACATCCAAGTTTGCTTGGGAGATTGTGATAATCTTCAGGACACTTGTCCAGCAGTTCCACCCAATAAGCAGACCATATTCATCAATGGTCTTCAATGCAAAAACCCAGTTAATGTAACAGCTCAAGATTTCAGGACCACAGAACTAAGCAAAGCTGGCCCTACAGACATTTTTGGTGCATCTTTGAAAATTGTGAGTGCTGCTGAGTTCAATGGTCTGAATACTCTTGGCCTCTCCATTGGAAGAATTGACCTTGATGGGAATGGCCTGGTGAACTTCCACTATCATCCTAGGGCTACTGAAATAATCTTTGTTACCAAAGGTGTGTTGTTGGCAGGTTTTGTTGACACCAAAAACCAGTTTTTCCAGAAGTTTCTTAAAGTTGGTGATGTCTTTGTGTTCCCCAAGGCTTTGTTCCACTTCTGTCTAAATACTGGTTTTGAAGAATCCACTGTTTTCTCAGTGTACAACAGCCAGAATCCTGGCTTTGTGTCCCTAAGTCCTACAACTTTTGACACAACATTGGAATCATTGGACAAGATCAAGAAGAGACTCATGTCACTCTCTGCCTCTGAAGCTTAA
Predicted protein sequences of Glyma08g24320
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g24320.1 sequence type=predicted peptide gene model=Glyma08g24320 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MKPFAPFFFMLLFLEAFSNIQVCLGDCDNLQDTCPAVPPNKQTIFINGLQCKNPVNVTAQDFRTTELSKAGPTDIFGASLKIVSAAEFNGLNTLGLSIGRIDLDGNGLVNFHYHPRATEIIFVTKGVLLAGFVDTKNQFFQKFLKVGDVFVFPKALFHFCLNTGFEESTVFSVYNSQNPGFVSLSPTTFDTTLESLDKIKKRLMSLSASEA*