Glyma08g24265 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g24265): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g24265): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g24265

Feature Type:	gene_model
Chromosome:	Gm08
Start:	18449193
stop:	18449915
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g24265

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G52920	AT	Annotation by Michelle Graham. TAIR10: plastidic pyruvate kinase beta subunit 1 \| chr5:21463680-21466612 FORWARD LENGTH=579	SoyBase	E_val: 4.00E-99	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006629	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipid metabolic process	SoyBase	N/A	ISS
GO:0006633	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process	SoyBase	N/A	ISS
GO:0010431	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed maturation	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0048316	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed development	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0000287	GO-mf	Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004743	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pyruvate kinase activity	SoyBase	N/A	ISS
GO:0030955	GO-mf	Annotation by Michelle Graham. GO Molecular Function: potassium ion binding	SoyBase	N/A	ISS
PTHR11817	Panther	PYRUVATE KINASE	JGI		ISS
PF00224	PFAM	Pyruvate kinase, barrel domain	JGI		ISS
UniRef100_I1KVW5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Pyruvate kinase (Fragment) n=1 Tax=Glycine max RepID=I1KVW5_SOYBN	SoyBase	E_val: 4.00E-118	ISS
UniRef100_I1KVW5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Pyruvate kinase (Fragment) n=1 Tax=Glycine max RepID=I1KVW5_SOYBN	SoyBase	E_val: 4.00E-118	ISS

Expression Patterns of Glyma08g24265

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g24265 not represented in the dataset	Glyma08g24265 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g24265 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g226500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g24265

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g24265

Limit To All Plant Sequences

>Glyma08g24265.1   sequence type=CDS   gene model=Glyma08g24265   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTATGGTTGTTAAGTCTACGACAAAGGATTCTGTGAAATGTGCAGTTGTTGATGGAGGAGAGCTCAAGTCAAGGATGCCAAAAGTTGTTCATGAACTGAAAAATTATTTGAAAAGTTGTGGTGTTGATATACATGTCATCATAAAAATTGAAAGTGCAAACTCTATACCAAATTTGCATTCAATTATCAGTGCATCTCATGGGACTATGGTTGCCAGAGGGGATCTTGGCGCTGAGCTCCCTATTGAAGAGGTTCCACTTTTGCAGGAAGAGATAATCAACCTATGTTGTAACATGGGAAAAGTTGTTATTGTGGCAACATATATGCTAGAAAGCATGATTGTTCACCCAACTCCAACTAGAGCAGAGGTATCAGATATAACAATTGTTGTTCGAGAAGGTTCTGATGGAATAATGTTGTCTGGAGAAACAACTCATGGAAAGTTCCCACTAAAAGCTATGCAAGTAATGCACACTGTAACATTGCGAACAGAAGCCACTATACCAGGTGGTAAAATGCCACCTAACATTGGTCAAGTGTTGAAGAACCACATGAGTGAGATGTTTACATACACCATGCAACCATGA

Predicted protein sequences of Glyma08g24265

Limit To All Plant Sequences

>Glyma08g24265.1   sequence type=predicted peptide   gene model=Glyma08g24265   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSMVVKSTTKDSVKCAVVDGGELKSRMPKVVHELKNYLKSCGVDIHVIIKIESANSIPNLHSIISASHGTMVARGDLGAELPIEEVPLLQEEIINLCCNMGKVVIVATYMLESMIVHPTPTRAEVSDITIVVREGSDGIMLSGETTHGKFPLKAMQVMHTVTLRTEATIPGGKMPPNIGQVLKNHMSEMFTYTMQP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain