SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G78900 | AT | Annotation by Michelle Graham. TAIR10: vacuolar ATP synthase subunit A | chr1:29660463-29664575 FORWARD LENGTH=623 | SoyBase | E_val: 0 | ISS |
| GO:0000902 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell morphogenesis | SoyBase | N/A | ISS |
| GO:0006007 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glucose catabolic process | SoyBase | N/A | ISS |
| GO:0006094 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gluconeogenesis | SoyBase | N/A | ISS |
| GO:0006096 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glycolysis | SoyBase | N/A | ISS |
| GO:0006098 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt | SoyBase | N/A | ISS |
| GO:0006816 | GO-bp | Annotation by Michelle Graham. GO Biological Process: calcium ion transport | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0006972 | GO-bp | Annotation by Michelle Graham. GO Biological Process: hyperosmotic response | SoyBase | N/A | ISS |
| GO:0007010 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization | SoyBase | N/A | ISS |
| GO:0007030 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi organization | SoyBase | N/A | ISS |
| GO:0007033 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vacuole organization | SoyBase | N/A | ISS |
| GO:0009266 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus | SoyBase | N/A | ISS |
| GO:0009555 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pollen development | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0010498 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process | SoyBase | N/A | ISS |
| GO:0015991 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport | SoyBase | N/A | ISS |
| GO:0016049 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell growth | SoyBase | N/A | ISS |
| GO:0046034 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ATP metabolic process | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0048193 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport | SoyBase | N/A | ISS |
| GO:0000325 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole | SoyBase | N/A | ISS |
| GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005773 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuole | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0005794 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009941 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0048046 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: apoplast | SoyBase | N/A | ISS |
| GO:0002020 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protease binding | SoyBase | N/A | ISS |
| GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
| GO:0046933 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism | SoyBase | N/A | ISS |
| GO:0046961 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism | SoyBase | N/A | ISS |
| KOG1352 | KOG | Vacuolar H+-ATPase V1 sector, subunit A | JGI | ISS | |
| PTHR15184 | Panther | ATP SYNTHASE | JGI | ISS | |
| PTHR15184:SF7 | Panther | HRCN | JGI | ISS | |
| PF00006 | PFAM | ATP synthase alpha/beta family, nucleotide-binding domain | JGI | ISS | |
| PF00306 | PFAM | ATP synthase alpha/beta chain, C terminal domain | JGI | ISS | |
| PF02874 | PFAM | ATP synthase alpha/beta family, beta-barrel domain | JGI | ISS | |
| UniRef100_D7EYG6 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: V-H(+)-ATPase subunit A n=2 Tax=Papilionoideae RepID=D7EYG6_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_I1KVU0 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KVU0_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma08g23990 not represented in the dataset |
Glyma08g23990 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma07g00430 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.08g224400 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma08g23990.1 sequence type=CDS gene model=Glyma08g23990 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGCCCGCCGTTTATGGAGCTCGCTTGACCACCTTCGAAGACTCCGAGAAGGAGAGTGAATACGGTTACGTTCGCAAGGTATCAGGACCAGTCGTCGTTGCAGATGGCATGGCTGGGGCTGCTATGTATGAACTCGTGCGTGTTGGTCATGATAATCTCATTGGTGAAATTATTCGTCTCGAAGGGAATTCTGCTACCATCCAAGTTTATGAGGAAACTGCTGGCTTGATGGTTAATGATCCGGTGTTACGGACTCACAAGCCTTTATCCGTGGAGTTGGGACCTGGAATACTGGGGAATATTTTCGATGGAATTCAGAGGCCTTTGAAAACTATTGCTAAACGATCTGGTGATGTCTATATTCCTCGTGGTGTCTCTGTTCCAGCACTCGACAAAGATACACTTTGGGAATTTCAACCTAAGAAAATTGGTGAAGGCGACCTTTTAACTGGTGGAGATTTATATGCTACTGTTTTTGAGAACAGTCTAATGCAACACCATATTGCACTTCCTCCTGATAACATGGGAAAGATTACCTACATTGCACCACCTGGCCAATATTCCATAAAGGATACTGTATTGGAACTTGAGTTTCAAGGTGTCAAAAAGAAATTCACCATGCTTCAGACTTGGCCCGTACGTACACCAAGGCCTGTTGCATCAAAACTTGCAGCTGATACTCCTCTTCTTACTGGTCAGCGTGTTCTTGATGCCCTTTTCCCCTCAGTTCTTGGCGGGACTTGTGCCATACCTGGAGCTTTTGGTTGTGGTAAAACTGTCATTAGTCAGGCTCTTTCTAAGTATTCCAATTCTGATGCCGTTGTTTATGTCGGCTGTGGGGAACGTGGAAATGAAATGGCAGAGGTTCTAATGGACTTTCCCCAACTTACAATGACATTACCTGATGGTCGTGAAGAATCTGTCATGAAGCGTACAACACTAGTGGCTAACACTTCAAACATGCCAGTGGCTGCTCGTGAAGCTTCAATTTATACAGGAATCACATTAGCTGAGTATTTCAGAGATATGGGTTATAATGTCAGTATGATGGCAGATTCTACATCTAGATGGGCAGAAGCATTGCGTGAAATCTCTGGACGACTGGCAGAAATGCCTGCAGATAGTGGATATCCTGCATACCTTGCTGCACGTTTAGCCTCGTTCTATGAACGTGCTGGGAAGGTAAAATGTCTTGGAGGCCCTGAACGTACAGGTAGCGTAACTATTGTTGGTGCTGTTTCGCCACCTGGAGGAGATTTCTCAGATCCTGTGACATCTGCAACCCTGAGCATAGTTCAGGTTTTCTGGGGTTTGGACAAAAAGCTTGCTCAGAGGAAGCACTTTCCTTCTGTAAACTGGCTTATTTCTTATTCAAAATACTCAACGGCACTTGAAACCTTTTATGAGCAATTTGATCCAGATTTTATCAACATTAGGACAAAGGCTCGTGAAGTTCTGCAAAGGGAAGATGACCTGAATGAAATTGTTCAGCTTGTGGGCAAGGATGCTTTAGCTGAAGGAGATAAGATCACCTTAGAAACTGCAAAGCTTTTGAGAGAGGATTATCTTGCTCAAAATGCCTTTACACCATATGACAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGATGCGCAACATTATCCATTTCTACAATTTGGCAAATCAGGCAGTAGAGAGGGGAGCTGGTTCAGATGGTCAGAAGATATCTTACACCCTTATCAAGCATCGTATGGGAGATCTGTTCTACCGATTAGTGTCTCAGAAATTTGAGGATCCAGCAGAAGGGGAAGCTGCTTTGGTTGCGAAATTTCAGAAGTTACATGAGGACCTGACTAATGGTTTCCGCAACCTTGAGGACGAAACCCGATGA
>Glyma08g23990.1 sequence type=predicted peptide gene model=Glyma08g23990 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MPAVYGARLTTFEDSEKESEYGYVRKVSGPVVVADGMAGAAMYELVRVGHDNLIGEIIRLEGNSATIQVYEETAGLMVNDPVLRTHKPLSVELGPGILGNIFDGIQRPLKTIAKRSGDVYIPRGVSVPALDKDTLWEFQPKKIGEGDLLTGGDLYATVFENSLMQHHIALPPDNMGKITYIAPPGQYSIKDTVLELEFQGVKKKFTMLQTWPVRTPRPVASKLAADTPLLTGQRVLDALFPSVLGGTCAIPGAFGCGKTVISQALSKYSNSDAVVYVGCGERGNEMAEVLMDFPQLTMTLPDGREESVMKRTTLVANTSNMPVAAREASIYTGITLAEYFRDMGYNVSMMADSTSRWAEALREISGRLAEMPADSGYPAYLAARLASFYERAGKVKCLGGPERTGSVTIVGAVSPPGGDFSDPVTSATLSIVQVFWGLDKKLAQRKHFPSVNWLISYSKYSTALETFYEQFDPDFINIRTKAREVLQREDDLNEIVQLVGKDALAEGDKITLETAKLLREDYLAQNAFTPYDKFCPFYKSVWMMRNIIHFYNLANQAVERGAGSDGQKISYTLIKHRMGDLFYRLVSQKFEDPAEGEAALVAKFQKLHEDLTNGFRNLEDETR*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
