SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g23370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g23370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g23370

Feature Type:gene_model
Chromosome:Gm08
Start:17834014
stop:17835560
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G58730AT Annotation by Michelle Graham. TAIR10: vacuolar ATP synthase subunit D (VATD) / V-ATPase D subunit / vacuolar proton pump D subunit (VATPD) | chr3:21718495-21719280 REVERSE LENGTH=261 SoyBaseE_val: 4.00E-144ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0015991GO-bp Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport SoyBaseN/AISS
GO:0000325GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0042626GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances SoyBaseN/AISS
GO:0046961GO-mf Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism SoyBaseN/AISS
KOG1647 KOG Vacuolar H+-ATPase V1 sector, subunit D JGI ISS
PTHR11671Panther ATP SYNTHASE SUBUNIT D JGI ISS
PF01813PFAM ATP synthase subunit D JGI ISS
UniRef100_G7JEF1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitochondrial ATP synthesis coupled proton transport protein n=1 Tax=Medicago truncatula RepID=G7JEF1_MEDTR SoyBaseE_val: 2.00E-161ISS
UniRef100_I1KVL9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KVL9_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g23370 not represented in the dataset

Glyma08g23370 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g02640 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g218500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g23370.2   sequence type=CDS   gene model=Glyma08g23370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGGGGCAAACGCAGCGTCTGAACGTGGTCCCCACCGTGACGATGCTGGGAGTGGTCAAGGCGCGTCTAGTCGGCGCCACGCGCGGTCACGCGCTCCTGAAGAAGAAGAGCGACGCGCTCACGGTGCAGTTCCGCCAGATCCTGAAGAAGATCGTGTCCACGAAAGAATCTATGGGCGACATCATGAAAACGTCGTCGTTCGCGCTCACCGAGGCAAAATACGTCGCCGGCGACAACATCAAGCACGTCGTCCTCGAAAACGTGAAAGAAGCCTCCCTCCGCGTCCGGTCGCGCCAGGAGAACGTCGCCGGAGTGAAACTCCCGAAATTCGACTACACCGCCGACGCCGACGCCACGAAAAACGACCTTACGGGACTCGCACGTGGTGGGCAGCAGGTGCAGCAGTGCCGCGCCGCCTACATCAAGGCAATCGAGGTGCTCGTGGAGCTCGCGTCCCTTCAGACGTCGTTTCTGACCCTCGATGAGGCCATCAAGACCACGAATCGTAGGGTTAACGCTCTGGAGAACGTGGTGAAGCCGCGACTCGAGAACACGATTAGTTACATCAAGGGGGAGCTGGACGAGCTCGAGAGGGAGGATTTCTTCAGGCTAAAGAAGATTCAGGGGTATAAGAAGAGGGAGATTGAGAGGCAGATGCTGCTGCAGAACAACTCCAATGTCGAGACTAATCTCCCTTTGCGCAAAGGGGTTTCGTACAATTCTGCTCACAATTTGTTGTCTGTGGGTGACAAAGATGAGGATATTATTTTCTGA

>Glyma08g23370.2   sequence type=predicted peptide   gene model=Glyma08g23370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGQTQRLNVVPTVTMLGVVKARLVGATRGHALLKKKSDALTVQFRQILKKIVSTKESMGDIMKTSSFALTEAKYVAGDNIKHVVLENVKEASLRVRSRQENVAGVKLPKFDYTADADATKNDLTGLARGGQQVQQCRAAYIKAIEVLVELASLQTSFLTLDEAIKTTNRRVNALENVVKPRLENTISYIKGELDELEREDFFRLKKIQGYKKREIERQMLLQNNSNVETNLPLRKGVSYNSAHNLLSVGDKDEDIIF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo