Glyma08g23272 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g23272): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g23272): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g23272

Feature Type:	gene_model
Chromosome:	Gm08
Start:	17741299
stop:	17746978
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g23272

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G31880	AT	Annotation by Michelle Graham. TAIR10: LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: Tudor/PWWP/MBT superfamily protein (TAIR:AT1G15940.1). \| chr4:15419435-15423939 REVERSE LENGTH=872	SoyBase	E_val: 5.00E-70	ISS
GO:0006312	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitotic recombination	SoyBase	N/A	ISS
GO:0007062	GO-bp	Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion	SoyBase	N/A	ISS
GO:0009560	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation	SoyBase	N/A	ISS
GO:0009630	GO-bp	Annotation by Michelle Graham. GO Biological Process: gravitropism	SoyBase	N/A	ISS
GO:0031048	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA	SoyBase	N/A	ISS
GO:0045132	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
PTHR12663	Panther	ANDROGEN INDUCED INHIBITOR OF PROLIFERATION (AS3) / PDS5-RELATED	JGI		ISS
UniRef100_G7JEE0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Sister chromatid cohesion protein PDS5-like protein n=1 Tax=Medicago truncatula RepID=G7JEE0_MEDTR	SoyBase	E_val: 3.00E-99	ISS
UniRef100_I1KVL1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KVL1_SOYBN	SoyBase	E_val: 4.00E-133	ISS

Expression Patterns of Glyma08g23272

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g23272 not represented in the dataset	Glyma08g23272 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g23272 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g217800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g23272

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g23272

Limit To All Plant Sequences

>Glyma08g23272.1   sequence type=CDS   gene model=Glyma08g23272   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGAATGCGAGTGAGAGGAATGCAACAACGAAGCTTAGACGTGTGGGGAAGAAGCTCCTCAAGAAATCTTCTGTTCATAAACTTCTGCCACTGCTTCAAAAATTGGAGTCGCTACTATCAAGCCTGGAACAAGAACCAACCGAGCCAATTCAAGAATCACTTGTACCTTCAAAGAAGGCTCTGATCTCCGACAAACTTTTGAGGCACACAGATGAGGATGTTAAGCTTTCAGTTTTATCTTGCATCACTGAGATTACAAGAATCACAGCACCAGATGCCCCTTATGATGATGAACAAATGAAGGAAATCTTCAAGCTTATAGCGGCATCTTTCGAGAAATTGTCTCACATATCTGGTCATGAAAAAGCACTTGACATACTTGATAATGTCGATAAGGTCAAATTATGCATGGTCATGCTGGACCTTGAGTGTAATGACCTGGCTATTGAAATGTTTAAGCATTTTCTGAGGTTTATAAGGTCAAACCATCCCCGTAACGCAATTCATTCAATGGAATCAATAATGACCCTGATTTTGCAAGAAAGTGATGACATTTCCCCGGATCTTCTTAGACCTCTGTTGGATAGTGTATGGAATGAAAATAAGGCTCTTTCACCTATGTCTTGGATATTGGGGGAGAAAGTAATTCGCAACTGTGCTGTTAAGCTCAAGCCCTATCTCATGAAGGCTGTGGAGTCCTCAGGCAGAGCTCTGAATGAGTATGCAGACATAGTAACTGATATTTGCCAGAACAAATCTGAATCTGTCAATGTGATTTTTCAAATGGTTCTGAACTTCTGA

Predicted protein sequences of Glyma08g23272

Limit To All Plant Sequences

>Glyma08g23272.1   sequence type=predicted peptide   gene model=Glyma08g23272   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMNASERNATTKLRRVGKKLLKKSSVHKLLPLLQKLESLLSSLEQEPTEPIQESLVPSKKALISDKLLRHTDEDVKLSVLSCITEITRITAPDAPYDDEQMKEIFKLIAASFEKLSHISGHEKALDILDNVDKVKLCMVMLDLECNDLAIEMFKHFLRFIRSNHPRNAIHSMESIMTLILQESDDISPDLLRPLLDSVWNENKALSPMSWILGEKVIRNCAVKLKPYLMKAVESSGRALNEYADIVTDICQNKSESVNVIFQMVLNF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain