Glyma08g23086 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g23086): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g23086): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g23086

Feature Type:	gene_model
Chromosome:	Gm08
Start:	17584955
stop:	17587204
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g23086

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G52060	AT	Annotation by Michelle Graham. TAIR10: BCL-2-associated athanogene 1 \| chr5:21152449-21153741 REVERSE LENGTH=342	SoyBase	E_val: 7.00E-38	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009750	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus	SoyBase	N/A	ISS
GO:0030003	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis	SoyBase	N/A	ISS
GO:0048767	GO-bp	Annotation by Michelle Graham. GO Biological Process: root hair elongation	SoyBase	N/A	ISS
GO:0070838	GO-bp	Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0051087	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chaperone binding	SoyBase	N/A	ISS
PTHR12329	Panther	BCL2-ASSOCIATED ATHANOGENE	JGI		ISS
PTHR12329:SF8	Panther	OS09G0524800 PROTEIN	JGI		ISS
UniRef100_G7IAQ7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: BAG-domain protein 1 / regulator of cell death n=1 Tax=Medicago truncatula RepID=G7IAQ7_MEDTR	SoyBase	E_val: 5.00E-36	ISS
UniRef100_UPI000233E093	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E093 related cluster n=1 Tax=unknown RepID=UPI000233E093	SoyBase	E_val: 7.00E-66	ISS

Expression Patterns of Glyma08g23086

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g23086 not represented in the dataset	Glyma08g23086 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g23086 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g215800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g23086

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g23086

Limit To All Plant Sequences

>Glyma08g23086.1   sequence type=CDS   gene model=Glyma08g23086   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGCCAAGTGCATCGCCCTCCAGCACAAGGTCCCGAAGGAACACGCCGCATCGTCATCTGACAACACACAAAAATTGGTGCACTGGAGCCCCGAATTGGTTACCGAATCCACCTTCACCTCTTCCCCTCACAAACCGCGCTCCAATCCATACTTTTCCTCTTCTTCTTCCTTCTCCCAACCTCCCACAACGTTCATGGTCAAAGTGAAGTATGGCTCATCCTATCACCAAATTCAAATCAGTTCTCATGCAAGTTTTGGGGAATTGAAGAAAATGTTAACAGAACCTACAGGATTGCACGTTCAGGATCGGAAATTGATTTACAAGAAAAAAGAGAGGGATTCAAAGTCATATCTTGATGTTGAGAGGGTCAAAGATGGATCAAAATTGGTGCTGCTTGTGGACATTGAGAGTAGAAAAAGAAGGTTACTTGAGATGTTAAAAATTGCTAAGAAGGAGAAGACATTAAAATCCTTGACAGAAATAAAGGTGGAGGTTGATAAACTTGCCAAGAAGGTAATAGCACCTAGTTTCACACTATTAATTTCCACAACGTGA

Predicted protein sequences of Glyma08g23086

Limit To All Plant Sequences

>Glyma08g23086.1   sequence type=predicted peptide   gene model=Glyma08g23086   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKAKCIALQHKVPKEHAASSSDNTQKLVHWSPELVTESTFTSSPHKPRSNPYFSSSSSFSQPPTTFMVKVKYGSSYHQIQISSHASFGELKKMLTEPTGLHVQDRKLIYKKKERDSKSYLDVERVKDGSKLVLLVDIESRKRRLLEMLKIAKKEKTLKSLTEIKVEVDKLAKKVIAPSFTLLISTT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain