Glyma08g22810 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g22810

Feature Type:	gene_model
Chromosome:	Gm08
Start:	17297910
stop:	17300486
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g22810

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G03500	AT	Annotation by Michelle Graham. TAIR10: Mediator complex, subunit Med7 \| chr5:876673-877660 REVERSE LENGTH=168	SoyBase	E_val: 3.00E-87	ISS
GO:0006357	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription from RNA polymerase II promoter	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0016592	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mediator complex	SoyBase	N/A	ISS
KOG0570	KOG	Transcriptional coactivator	JGI		ISS
PTHR21428	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR21428:SF6	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF05983	PFAM	MED7 protein	JGI		ISS
UniRef100_B0BLB1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CM0545.310.nc protein n=1 Tax=Lotus japonicus RepID=B0BLB1_LOTJA	SoyBase	E_val: 8.00E-96	ISS
UniRef100_C6TKC3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKC3_SOYBN	SoyBase	E_val: 3.00E-118	ISS

Expression Patterns of Glyma08g22810

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g22810

Paralog	Evidence	Comments
Glyma07g03300	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g22810 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g213500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g22810

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g22810

Limit To All Plant Sequences

>Glyma08g22810.1   sequence type=CDS   gene model=Glyma08g22810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGACGGCAACATACCCTCCACCGCCACCTTATTACAGGCTTTACAAAGATTACTTGCAAGACCCTAATTCTGCTCCCGACCCTCCACCACCTATTGAAGGCACTTATCTTTGTTTTGGAGCCAATTACACTACTAGTGATGTTCTACCTACCTTGGAAGAACAAGGGGTGCGCCAGCTCTATTCTAAGGGCCCTAATGTTGATTTCAAGAAAGAGCTGAGGTCACTCAACGGAGAGTTGCAACTACATGTTTTGGAGCTTGCTGATATTCTTATTGAGAGGCCTTCACAGTATGCAAGAAGAGTAGAAGAAATTTCAACTGTATTCAAAAACTTACATCACCTTTTAAATTCATTGCGTCCTCATCAGGCGAGAGCAACATTGATTCATATTTTGGAACTTCAGATACAGCGTCGTAAACAAGCAGTGGAAGACATAAAGAAGAGGAGAGAAGAAGCCCGAAGGCTCCTTAACGAGTCCTTGGCAACACTTGATGGCCATTAG

Predicted protein sequences of Glyma08g22810

Limit To All Plant Sequences

>Glyma08g22810.1   sequence type=predicted peptide   gene model=Glyma08g22810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATATYPPPPPYYRLYKDYLQDPNSAPDPPPPIEGTYLCFGANYTTSDVLPTLEEQGVRQLYSKGPNVDFKKELRSLNGELQLHVLELADILIERPSQYARRVEEISTVFKNLHHLLNSLRPHQARATLIHILELQIQRRKQAVEDIKKRREEARRLLNESLATLDGH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain