SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g22540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g22540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g22540

Feature Type:gene_model
Chromosome:Gm08
Start:17112131
stop:17114496
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g22540
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G80160AT Annotation by Michelle Graham. TAIR10: Lactoylglutathione lyase / glyoxalase I family protein | chr1:30151101-30151930 FORWARD LENGTH=167 SoyBaseE_val: 1.00E-78ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0046482GO-bp Annotation by Michelle Graham. GO Biological Process: para-aminobenzoic acid metabolic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004462GO-mf Annotation by Michelle Graham. GO Molecular Function: lactoylglutathione lyase activity SoyBaseN/AISS
KOG2944 KOG Glyoxalase JGI ISS
PTHR10374Panther LACTOYLGLUTATHIONE LYASE JGI ISS
PTHR10374:SF0Panther LACTOYLGLUTATHIONE LYASE (GLYOXALASE I) JGI ISS
PF00903PFAM Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily JGI ISS
UniRef100_B4UW95UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lactoylglutathione lyase n=1 Tax=Arachis hypogaea RepID=B4UW95_ARAHY SoyBaseE_val: 2.00E-81ISS
UniRef100_I1KVC8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KVC8_SOYBN SoyBaseE_val: 2.00E-100ISS

Expression Patterns of Glyma08g22540
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g22540 not represented in the dataset
Glyma08g22540 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g22540
ParalogEvidenceComments
Glyma07g03560 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g22540 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g211100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g22540
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g22540
>Glyma08g22540.1   sequence type=CDS   gene model=Glyma08g22540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGAGAGTACCATGGGAAACCCTTTGCGCCTTCAATCTGTGAACCATATCTCCCTCATATGCAGATCAGTGGAACAATCAATGGATTTCTACCAGAACGTTCTGGGATTTTACCCCATCAGGAGGCCTGGCTCTTTAGATTTTGATGGGGCATGGCTATTCGGCTACGGAATTGGAATTCATTTGCTAGAAGCAGAGAACCCTGAAAATTTGCCAAAGAAGAAGGAAATCAATCCCAAGGATAATCATATATCTTTCCAGTGTGAGAGCATGGAGCCAGTGGAGAAGAAGCTGAAAGAAATGGAAATCGATTATGTGCGAGCAACTGTAGAGGAAGGTAGAATCCAAGTGGATCAACTGTTTTTCCACGACCCTGATGATTTCATGATCGAGATATGCAACTGTGATTCCCTTAGTAGGTGA
Predicted protein sequences of Glyma08g22540
>Glyma08g22540.1   sequence type=predicted peptide   gene model=Glyma08g22540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKESTMGNPLRLQSVNHISLICRSVEQSMDFYQNVLGFYPIRRPGSLDFDGAWLFGYGIGIHLLEAENPENLPKKKEINPKDNHISFQCESMEPVEKKLKEMEIDYVRATVEEGRIQVDQLFFHDPDDFMIEICNCDSLSR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo