SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g21921

Feature Type:gene_model
Chromosome:Gm08
Start:16675022
stop:16676935
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g21921
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G33030AT Annotation by Michelle Graham. TAIR10: receptor like protein 25 | chr2:14017684-14018340 REVERSE LENGTH=218 SoyBaseE_val: 3.00E-39ISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
PTHR26393Panther FAMILY NOT NAMED JGI ISS
PTHR26393:SF500Panther JGI ISS
PF00560PFAM Leucine Rich Repeat JGI ISS
UniRef100_G7KB81UniRef Annotation by Michelle Graham. Most informative UniRef hit: Receptor protein kinase-like protein n=2 Tax=Medicago truncatula RepID=G7KB81_MEDTR SoyBaseE_val: 4.00E-80ISS
UniRef100_I1MAT8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MAT8_SOYBN SoyBaseE_val: 1.00E-94ISS

Expression Patterns of Glyma08g21921
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g21921 not represented in the dataset
Glyma08g21921 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g21921 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g205100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g21921
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g21921
>Glyma08g21921.1   sequence type=CDS   gene model=Glyma08g21921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCTGGAGAGGATCTTTAACTACTTTCACAACTATTGATTTGTCAAATAACAGATTTGGAGGAGTGATCCCAGCAATCATTGGAGAGTTAAAGTCACTCAACGGGCTTAACCTTTCCCACAACAGAATTACTGGTGTTATTCCACAAAACTTTGGTGGTTTGGAAAATCTAGAATGGTTAGACCTCTCTTCAAACATGTTAATGGGTGAAATTCCAAAGGCATTGACCAATCTTCACTTCCTCTCTTCATTAAACCTTTCACAAAATCAGCTGGTGGGGATGATACCAACAGTTAAACAGTTCGAAACATTCCAGAATGATTCCTATGAAGGCAATCAAGGGCTATGTGGGTTGCCTTTGTCAAAGTCTTGCCACAATGATGAAAAACTGCCAACAGATTCAGCAACATTTCAGCATGATGAAGAATTCAGGTTTGGTTGGAAACCCGTAGCTATAGGATATGCATGTGGAGGGGTATTTGGAATACTATTGGGTTATATTGTCTTCTTTCGGAAACCAGAATGGTCAATCAGTTTTGTTGAAGGCATTCTTAATCAAAGAGTGAGAAAGAAAAGCAACAAATCTAATGCAAATACAAGACGATACGATCAAGGTCGTTAA
Predicted protein sequences of Glyma08g21921
>Glyma08g21921.1   sequence type=predicted peptide   gene model=Glyma08g21921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSWRGSLTTFTTIDLSNNRFGGVIPAIIGELKSLNGLNLSHNRITGVIPQNFGGLENLEWLDLSSNMLMGEIPKALTNLHFLSSLNLSQNQLVGMIPTVKQFETFQNDSYEGNQGLCGLPLSKSCHNDEKLPTDSATFQHDEEFRFGWKPVAIGYACGGVFGILLGYIVFFRKPEWSISFVEGILNQRVRKKSNKSNANTRRYDQGR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo