SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g19681

Feature Type:gene_model
Chromosome:Gm08
Start:14864180
stop:14866649
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g19681
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G17570AT Annotation by Michelle Graham. TAIR10: GATA transcription factor 26 | chr4:9784329-9786974 REVERSE LENGTH=510 SoyBaseE_val: 8.00E-13ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PF00320PFAM GATA zinc finger JGI ISS
UniRef100_G7L9J6UniRef Annotation by Michelle Graham. Most informative UniRef hit: GATA transcription factor n=1 Tax=Medicago truncatula RepID=G7L9J6_MEDTR SoyBaseE_val: 2.00E-21ISS
UniRef100_UPI0002339246UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339246 related cluster n=1 Tax=unknown RepID=UPI0002339246 SoyBaseE_val: 4.00E-38ISS

Expression Patterns of Glyma08g19681
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g19681 not represented in the dataset
Glyma08g19681 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g19681 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g184500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g19681
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g19681
>Glyma08g19681.1   sequence type=CDS   gene model=Glyma08g19681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACTCCACTTTGGCCTAATGGACCAGCTGATAAACCGGTGTTGTGTAACGCTTGTGGATCAAGATACAAGACAAGAGGACACCTTGACAATTATCTTCCCAAGAATGTCCATCCTCAGCCACACCACAAGAAATTTAAAAATGTAAATAGCGGAGGAAGTAATCTCAATGTTGAGCCTGAGCTTGAGTCCGGCAACCAACTTTTAAACCATGTTTCGCCTAGATCTACAACTAATGGTGACAGCGACAAGTTAACCTTAGATGTCCATCATATATCACCACAAGATTTTGGGAAGAAGATCCCATCAAAGAAACGGTCACCGATGGTGTACAAGCGTATGATACCAATGGAGAAGTTTCAAAAGCAGCTTGTTAAGTTGTATAAAAGTGAAAGACAACCAGAAGAGAGTGTTTTGGTGGATAACATGATGAACTTCATACCCGAAAATGAGATAGGACTTGGAACCATTCTTCTTAAGACAAATGATGATGATGCTTCTTCTACAGATAAATGTGGATCATCCACATCTGCACCCTGA
Predicted protein sequences of Glyma08g19681
>Glyma08g19681.1   sequence type=predicted peptide   gene model=Glyma08g19681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TPLWPNGPADKPVLCNACGSRYKTRGHLDNYLPKNVHPQPHHKKFKNVNSGGSNLNVEPELESGNQLLNHVSPRSTTNGDSDKLTLDVHHISPQDFGKKIPSKKRSPMVYKRMIPMEKFQKQLVKLYKSERQPEESVLVDNMMNFIPENEIGLGTILLKTNDDDASSTDKCGSSTSAP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo