SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g19170

Feature Type:gene_model
Chromosome:Gm08
Start:14466236
stop:14468766
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g19170
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G64120AT Annotation by Michelle Graham. TAIR10: Peroxidase superfamily protein | chr5:25659551-25660946 REVERSE LENGTH=328 SoyBaseE_val: 7.00E-132ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0045730GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0004601GO-mf Annotation by Michelle Graham. GO Molecular Function: peroxidase activity SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
PF00141PFAM Peroxidase JGI ISS
UniRef100_C6TF32UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TF32_SOYBN SoyBaseE_val: 0ISS
UniRef100_P22196UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cationic peroxidase 2 n=1 Tax=Arachis hypogaea RepID=PER2_ARAHY SoyBaseE_val: 7.00E-151ISS

Expression Patterns of Glyma08g19170
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g19170
ParalogEvidenceComments
Glyma15g05831 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g19170 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g179600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g19170
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g19170
>Glyma08g19170.1   sequence type=CDS   gene model=Glyma08g19170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGTGGTTTGTGGAAGAAAGAGTTGGTTCTAAGGTTTGTTGTGCTTGCTGTGGCTGTTGTGAACACAGTGCAATGGAATGGAGAAGGCACGCGTGTAGGGTTCTATTCGAGCACATGTCCACGTGCCGAGTCCATTGTCAGGTCCACAGTGGAATCCCACCTTAGGTCAGACCCTACTTTAGCTGGTCCAATACTTAGGATGCACTTCCATGATTGCTTTGTGCGAGGTTGTGACGCTTCTGTTCTCATAGCCGGTGCTGGCACTGAGAGAACAGCGGGGCCAAACCTTAGTTTGAGAGGATTTGATGTCATTGACGATGCTAAGGCTAAGATCGAGGCTCTGTGCCCTGGTGTTGTCTCTTGTGCTGATATCCTTAGCCTTGCTGCTCGTGATTCTGTAGTTCTGAGTGGTGGACTAAGTTGGCAAGTGCCCACAGGACGCAAAGATGGAAGGGTTTCAATTGGATCAGAAGCCTTAACTTTGCCTGGTCCTAATGATACCGTCGCAACCCAGAAGGATAAGTTTTCAAACAAGGGCCTTAACACCGAAGACCTCGTCATTCTTGCTGGTGGGCATACGATAGGTACAAGTGCTTGCCGATCTTTCGCAGACAGAATATACAACCCCAATGGCACTGATCCTTCCATCGACCCTTCATTTCTTCCATTTCTGCGACAAATTTGCCCACAAACACAACCAACGAAGCGAGTGGCACTAGACACAGGAAGCCAATTCAAATTCGACACGTCCTACTTCGCTCACCTAGTTAGAGGCCGTGGAATTCTCCGTTCTGATCAGGTTCTTTGGACTGATGCTTCCACAAGAGGCTTTGTTCAGAAATACTTAGCCACAGGTCCCTTCAAGGTCCAATTCGGAAAGTCTATGATCAAGATGAGCAACATTGGTGTCAAGACCGGTTCTCAGGGTGAAATTCGCAAGATATGTTCTGCTATTAATTAA
Predicted protein sequences of Glyma08g19170
>Glyma08g19170.1   sequence type=predicted peptide   gene model=Glyma08g19170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGGLWKKELVLRFVVLAVAVVNTVQWNGEGTRVGFYSSTCPRAESIVRSTVESHLRSDPTLAGPILRMHFHDCFVRGCDASVLIAGAGTERTAGPNLSLRGFDVIDDAKAKIEALCPGVVSCADILSLAARDSVVLSGGLSWQVPTGRKDGRVSIGSEALTLPGPNDTVATQKDKFSNKGLNTEDLVILAGGHTIGTSACRSFADRIYNPNGTDPSIDPSFLPFLRQICPQTQPTKRVALDTGSQFKFDTSYFAHLVRGRGILRSDQVLWTDASTRGFVQKYLATGPFKVQFGKSMIKMSNIGVKTGSQGEIRKICSAIN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo