Glyma08g18970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g18970

Feature Type:	gene_model
Chromosome:	Gm08
Start:	14314915
stop:	14319825
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g18970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G65260	AT	Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein \| chr5:26080501-26082984 REVERSE LENGTH=220	SoyBase	E_val: 2.00E-99	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003676	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
KOG4209	KOG	Splicing factor RNPS1, SR protein superfamily	JGI		ISS
PTHR23365	Panther	POLY-A BINDING PROTEIN 2	JGI		ISS
PF00076	PFAM	RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)	JGI		ISS
UniRef100_C6T922	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T922_SOYBN	SoyBase	E_val: 2.00E-145	ISS
UniRef100_G7JCS4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Polyadenylate-binding protein n=1 Tax=Medicago truncatula RepID=G7JCS4_MEDTR	SoyBase	E_val: 2.00E-114	ISS

Expression Patterns of Glyma08g18970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g18970

Paralog	Evidence	Comments
Glyma15g06030	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g18970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g177900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g18970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g18970

Limit To All Plant Sequences

>Glyma08g18970.1   sequence type=CDS   gene model=Glyma08g18970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACGACGACGTCGACATGCACGCTGCCGACACCAACGAGGAATTGGATGACATGAAGAAGCGCTTGAAGGAGATGGAAGATGAAGCTGCTGCTTTGCGAGAGATGCAGGCCAAGGTCGAGAAGGAAATGGGATCCGTGCAAGATCCTGCAAATGCTTCTGCGAGTCAGGCCAATAAAGAGGAAATAGATTCTCGATCAGTCTTTGTAGGCAATGTGGACTATTCATGCACTCCTGAGGAAGTGCAACAGCATTTTCAGTCTTGTGGAACAGTAAACAGAATCACCATTCGAACTGATAAGTTTGGCCAACCCAAGGGTTATGCGTATGTTGAGTTCCTTGAGGTGGAGGCTGTTCAGGAGGCCCTTTTGCTGAATGAATCTGAACTTCATGGGCGCCAATTAAAGGTAACGGCTAAAAGGACCAACATACCAGGGATGAAACAGTATCGTCCCCGACGGTCCACCAATCCTTACATGGGGGGGTTGCGAGGCAGAACCCCATATGCAGCTCCTTTTATCTACTCTCCATATGGATATGGAAAGGTTCCAAGGTTCAGAATGGCAATGCGCCACAGCCCCTACTATTGA

Predicted protein sequences of Glyma08g18970

Limit To All Plant Sequences

>Glyma08g18970.1   sequence type=predicted peptide   gene model=Glyma08g18970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENDDVDMHAADTNEELDDMKKRLKEMEDEAAALREMQAKVEKEMGSVQDPANASASQANKEEIDSRSVFVGNVDYSCTPEEVQQHFQSCGTVNRITIRTDKFGQPKGYAYVEFLEVEAVQEALLLNESELHGRQLKVTAKRTNIPGMKQYRPRRSTNPYMGGLRGRTPYAAPFIYSPYGYGKVPRFRMAMRHSPYY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain