Report for Sequence Feature Glyma08g17870
Feature Type: gene_model
Chromosome: Gm08
Start: 13339050
stop: 13343365
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g17870
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G31340 AT
Annotation by Michelle Graham. TAIR10: related to ubiquitin 1 | chr1:11218076-11219417 REVERSE LENGTH=156
SoyBase E_val: 2.00E-104 ISS
GO:0006464 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular protein modification process
SoyBase N/A ISS
GO:0009693 GO-bp
Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process
SoyBase N/A ISS
GO:0009733 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus
SoyBase N/A ISS
GO:0009790 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryo development
SoyBase N/A ISS
GO:0045116 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein neddylation
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
KOG0005
KOG
Ubiquitin-like protein
JGI ISS
PTHR10666 Panther
UBIQUITIN
JGI ISS
PF00240 PFAM
Ubiquitin family
JGI ISS
UniRef100_C6SXX2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SXX2_SOYBN
SoyBase E_val: 2.00E-104 ISS
UniRef100_G7K8J5 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Bi-ubiquitin n=1 Tax=Medicago truncatula RepID=G7K8J5_MEDTR
SoyBase E_val: 1.00E-102 ISS
Expression Patterns of Glyma08g17870
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma08g17870
Paralog Evidence Comments
Glyma15g41230 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g17870 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g168200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g17870
Coding sequences of Glyma08g17870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g17870.1 sequence type=CDS gene model=Glyma08g17870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCAGATCTTCGTCAAGACTTTGACCGGCAAGACCATCACCCTCGAGGTCGAGAGCAGCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAAGGTATCCCTCCTGACCAGCAGAGGTTGATTTTTGCTGGTAAGCAGCTGGAAGATGGTCGCACTCTTGCTGATTATAACATACAAAAGGAATCAACACTTCACTTGGTCTTGAGGCTAAGGGGAGGTACCATGATTAAAGTGAAGACTTTAACTGGGAAAGAAATTGAAATTGACATTGAACCAACTGATACAATCGACCGGATCAAGGAACGTGTAGAAGAAAAAGAGGGAATTCCACCTGTGCAGCAGAGACTCATATATGCCGGTAAGCAGCTTGCTGATGACAAAACAGCTAAAGAGTACAACATTGAGGGTGGTTCTGTACTTCACTTGGTGCTTGCATTGAGGGGTGGTACTTATTAG
Predicted protein sequences of Glyma08g17870
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g17870.1 sequence type=predicted peptide gene model=Glyma08g17870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGTMIKVKTLTGKEIEIDIEPTDTIDRIKERVEEKEGIPPVQQRLIYAGKQLADDKTAKEYNIEGGSVLHLVLALRGGTY*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
