SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma08g17870

Feature Type:gene_model
Chromosome:Gm08
Start:13339050
stop:13343365
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G31340AT Annotation by Michelle Graham. TAIR10: related to ubiquitin 1 | chr1:11218076-11219417 REVERSE LENGTH=156 SoyBaseE_val: 2.00E-104ISS
GO:0006464GO-bp Annotation by Michelle Graham. GO Biological Process: cellular protein modification process SoyBaseN/AISS
GO:0009693GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0045116GO-bp Annotation by Michelle Graham. GO Biological Process: protein neddylation SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
KOG0005 KOG Ubiquitin-like protein JGI ISS
PTHR10666Panther UBIQUITIN JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
UniRef100_C6SXX2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SXX2_SOYBN SoyBaseE_val: 2.00E-104ISS
UniRef100_G7K8J5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Bi-ubiquitin n=1 Tax=Medicago truncatula RepID=G7K8J5_MEDTR SoyBaseE_val: 1.00E-102ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma15g41230 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g168200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g17870.1   sequence type=CDS   gene model=Glyma08g17870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGATCTTCGTCAAGACTTTGACCGGCAAGACCATCACCCTCGAGGTCGAGAGCAGCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAAGGTATCCCTCCTGACCAGCAGAGGTTGATTTTTGCTGGTAAGCAGCTGGAAGATGGTCGCACTCTTGCTGATTATAACATACAAAAGGAATCAACACTTCACTTGGTCTTGAGGCTAAGGGGAGGTACCATGATTAAAGTGAAGACTTTAACTGGGAAAGAAATTGAAATTGACATTGAACCAACTGATACAATCGACCGGATCAAGGAACGTGTAGAAGAAAAAGAGGGAATTCCACCTGTGCAGCAGAGACTCATATATGCCGGTAAGCAGCTTGCTGATGACAAAACAGCTAAAGAGTACAACATTGAGGGTGGTTCTGTACTTCACTTGGTGCTTGCATTGAGGGGTGGTACTTATTAG

>Glyma08g17870.1   sequence type=predicted peptide   gene model=Glyma08g17870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGTMIKVKTLTGKEIEIDIEPTDTIDRIKERVEEKEGIPPVQQRLIYAGKQLADDKTAKEYNIEGGSVLHLVLALRGGTY*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo