SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g16030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g16030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g16030

Feature Type:gene_model
Chromosome:Gm08
Start:11698888
stop:11703377
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40850AT Annotation by Michelle Graham. TAIR10: urophorphyrin methylase 1 | chr5:16367205-16368724 FORWARD LENGTH=369 SoyBaseE_val: 3.00E-180ISS
GO:0006567GO-bp Annotation by Michelle Graham. GO Biological Process: threonine catabolic process SoyBaseN/AISS
GO:0006779GO-bp Annotation by Michelle Graham. GO Biological Process: porphyrin-containing compound biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0019354GO-bp Annotation by Michelle Graham. GO Biological Process: siroheme biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004851GO-mf Annotation by Michelle Graham. GO Molecular Function: uroporphyrin-III C-methyltransferase activity SoyBaseN/AISS
GO:0008168GO-mf Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity SoyBaseN/AISS
GO:0043115GO-mf Annotation by Michelle Graham. GO Molecular Function: precorrin-2 dehydrogenase activity SoyBaseN/AISS
KOG1527 KOG Uroporphyrin III methyltransferase JGI ISS
PTHR21091Panther METHYLTETRAHYDROFOLATE:HOMOCYSTEINE METHYLTRANSFERASE RELATED JGI ISS
PTHR21091:SF16Panther UROPORPHYRIN-III METHYLTRANSFERASE JGI ISS
PF00590PFAM Tetrapyrrole (Corrin/Porphyrin) Methylases JGI ISS
UniRef100_A5A2I8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Uroporphiryn-III C-methyltransferase n=1 Tax=Medicago truncatula RepID=A5A2I8_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0001CDD8F9UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001CDD8F9 related cluster n=1 Tax=unknown RepID=UPI0001CDD8F9 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g16030 not represented in the dataset

Glyma08g16030 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g150800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g16030.1   sequence type=CDS   gene model=Glyma08g16030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCTCCTCCACAAGCTCGCACCTTTCACCTCTCTCTACACCAATACCCCCCATTCCCCACCACCCCGCCGCCACGTCATCATCTCCTTCTCCGTCTCACCCTTCACCGAGAAGCACTCCACAGAGCGCTACCAGAGGGACCAATGGGTCTACCAGAGCACCACTCAAGAGGGTCAACCTCAAACGACGCCGTTTCCTCCTCTCCCGTGCGATTCAGCGTCCTTAAGAGACGACGACATAGCGTTGCAGCTGCCAGAGCTGAAGAAGCTGCTTCAGGTTCTGAGGGAGAAGAGGGAGTGTATCAATGGAGAGGGTTGTGAGCCGGGGAATGTGTTCTTGGTGGGAACGGGACCTGGGGACCCTGAGCTTCTCACTCTCAAGGCTGTGAGAGTCATCAAGAGTGCTGATCTTTTGCTCTATGACAGGTTGGTGTCCAATGATGTGCTGGATTTGGTTGGCCCCGGTGCTAGGCTTCTCTATGTGGGCAAGACTGCTGGGTATCATAGCAGAACACAGGAGGAAATACATGAGCTTCTTTTGAGTTTTGCAGAAGCTGGGGCAACTGTTGTGAGACTTAAAGGGGGTGATCCATTGGTGTTTGGCAGGGGTGGGGAGGAAATGGATTTTTTGCAACAGCAAGGTATCCAAGTGAAAGTTATTCCAGGTATAACTGCTGCATCTGGAATAGCAGCAGAGCTTGGAATTCCATTAACTCACCGTGGCATTGCAAATAGTGTGAGATTCCTCACAGGGCATTCAAGGAAAGGAGGATCCGATCCTCTCTTTGTATCGGAAAATGCTGCTGATCCGGATTCTACCTTGGTGGTTTACATGGGCTTGGCGACCTTCCCTTCACTTGCACAGAAGCTAATGCATCATGGTCTGTCCCCTCAGACCCCAGCTGCAGCCATTGAGCGAGGAACCACACTTCATCAGCGCACGGTGTTTGCTGAACTAAAGGACCTTCACGAGAAAATTACATCTGCTCAGCTGGTGTCACCAACGCTGATTATTATAGGAAAAGTTGTTGAACTATCACCATTTTGGCCAATTCCTACAAAAGAAGAATCATGTTTAATGCAGGCATGA

>Glyma08g16030.1   sequence type=predicted peptide   gene model=Glyma08g16030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALLHKLAPFTSLYTNTPHSPPPRRHVIISFSVSPFTEKHSTERYQRDQWVYQSTTQEGQPQTTPFPPLPCDSASLRDDDIALQLPELKKLLQVLREKRECINGEGCEPGNVFLVGTGPGDPELLTLKAVRVIKSADLLLYDRLVSNDVLDLVGPGARLLYVGKTAGYHSRTQEEIHELLLSFAEAGATVVRLKGGDPLVFGRGGEEMDFLQQQGIQVKVIPGITAASGIAAELGIPLTHRGIANSVRFLTGHSRKGGSDPLFVSENAADPDSTLVVYMGLATFPSLAQKLMHHGLSPQTPAAAIERGTTLHQRTVFAELKDLHEKITSAQLVSPTLIIIGKVVELSPFWPIPTKEESCLMQA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo