SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g15830

Feature Type:gene_model
Chromosome:Gm08
Start:11517071
stop:11518015
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g15830
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G68550AT Annotation by Michelle Graham. TAIR10: Integrase-type DNA-binding superfamily protein | chr1:25725810-25726784 REVERSE LENGTH=324 SoyBaseE_val: 6.00E-41ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF00847PFAM AP2 domain JGI ISS
UniRef100_G7ZZD4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ethylene responsive transcription factor 2a n=1 Tax=Medicago truncatula RepID=G7ZZD4_MEDTR SoyBaseE_val: 6.00E-56ISS
UniRef100_UPI0002338A03UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338A03 related cluster n=1 Tax=unknown RepID=UPI0002338A03 SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g15830
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g15830 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g149200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g15830
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g15830
>Glyma08g15830.2   sequence type=CDS   gene model=Glyma08g15830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGAAAACTGCACATCATTTGCAACGATCCTGATGCTACTGATTCATCCGAAGATGAGTTGGAGAGGATTCAGAACCCGAGAAGAGTAAAAAGAAGTGCATGTGAGATCCCTCTTCCTCACACATTCACCACTCCTGAAATGAGGGTTAGCACTAAAGATCAACCCCAAAGTAAGAAGAGGGCTTTGACTCATACCCCATCAGCGAGGAGGAACACTTCTAGGAAATATAGAGGTGTTAGGCAGAGAAAATGGGGAAAATGGGCCGCTGAGATATATAACCCATTTCAGAGTACTCGTATATGGATAGGCACTTTCAGCACTGCAGAAGAGGCTTCCCAAGCCTATGAGGCCAGAAGGCTTGAGTTTGAAGCTATGGCAAAGGCTCAAGCTTACAAAACTGGTTCTCGTTCTGCTGCTGAACCTTTGGCTACAACTTCTGAGAAGAGTAACTGCCGTAACTCCTCTTCTGCTGCTGCTGCAGTTGATGTGTCTGTATCTGAGAAGGTTTCTACTACTTCTGATGACTCAGACAAAAGTGTGTTGTCACACAATTCACCATTGTCTGTGCTTGAGTTGGATACCCCAGCTTCCAAATTCATTGAGATGGGTAATGTTTCAACTGACGAAGCTATTGAGGCTAACAATTTGGTCGATGAACTTGCAGAGCTAGAGATACCAGATTTGAATCTGTTGAACTTGCCGCCACCACCATCTGCTGCTGTTCCATCTGAGATTGAGCCAAACTTTGGGCTTGATTTTGATTGGCTATCGTTCGATGATTATGGACAGGGTTTTGATGATTTTGGTGGCTTGGAAGATATTCATATTTGTGGGTTTGATGACAATGAGCCTAGTGAGCTTCCTGATTTCGATTTTGGTGATTTTGGTGCTGATGAGTTTTCTGGTTGGACTGAGGATCCCCTCAATATACATTATGCCTAA
Predicted protein sequences of Glyma08g15830
>Glyma08g15830.2   sequence type=predicted peptide   gene model=Glyma08g15830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRKLHIICNDPDATDSSEDELERIQNPRRVKRSACEIPLPHTFTTPEMRVSTKDQPQSKKRALTHTPSARRNTSRKYRGVRQRKWGKWAAEIYNPFQSTRIWIGTFSTAEEASQAYEARRLEFEAMAKAQAYKTGSRSAAEPLATTSEKSNCRNSSSAAAAVDVSVSEKVSTTSDDSDKSVLSHNSPLSVLELDTPASKFIEMGNVSTDEAIEANNLVDELAELEIPDLNLLNLPPPPSAAVPSEIEPNFGLDFDWLSFDDYGQGFDDFGGLEDIHICGFDDNEPSELPDFDFGDFGADEFSGWTEDPLNIHYA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo