SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g14431): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g14431): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g14431

Feature Type:gene_model
Chromosome:Gm08
Start:10477254
stop:10482289
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G65000AT Annotation by Michelle Graham. TAIR10: Nucleotide-sugar transporter family protein | chr5:25965123-25967307 REVERSE LENGTH=325 SoyBaseE_val: 5.00E-169ISS
GO:0008643GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate transport SoyBaseN/AISS
GO:0010584GO-bp Annotation by Michelle Graham. GO Biological Process: pollen exine formation SoyBaseN/AISS
GO:0015780GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide-sugar transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0000139GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005338GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide-sugar transmembrane transporter activity SoyBaseN/AISS
GO:0005351GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity SoyBaseN/AISS
KOG2234 KOG Predicted UDP-galactose transporter JGI ISS
PTHR10231Panther SUGAR TRANSPORTER JGI ISS
PTHR10231:SF3Panther gb def: putative protein [arabidopsis thaliana] JGI ISS
PF04142PFAM Nucleotide-sugar transporter JGI ISS
UniRef100_B9SZ37UniRef Annotation by Michelle Graham. Most informative UniRef hit: UDP-N-acetylglucosamine transporter, putative n=1 Tax=Ricinus communis RepID=B9SZ37_RICCO SoyBaseE_val: 8.00E-180ISS
UniRef100_I1KT16UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KT16_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g14431 not represented in the dataset

Glyma08g14431 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g135800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma08g14431.1   sequence type=CDS   gene model=Glyma08g14431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCCACCGGCACCACCCAAGTCAAGTCAGGGTCAGGTGATGAATAATGCAAGGATTCACTTCTTTTCCATTCTCCTCGCTCTCCAATACGGTGCTCAACCTTTGATCTCCAAACGCTTCATCAGACGTGAAGTTATTGTGACTTCATCTGTTTTGACTTGTGAGCTTGCAAAGGTTATATGTGCAGTGTTTTTTATGGCAAAAGATGGTAGTCTGAGGAAATTGTATAAAGAGTGGACTTTGGTTGGTGCGTTGACTGCATCAGGACTTCCTGCAGCTATATATGCATTGCAAAATAGTTTGCTGCAAATTTCTTACAAGAATCTTGATTCACTCACATTCTCAATGCTGAATCAGACCAAAATATTTTTCACCGCGCTCTTTGCATATTTCATATTGAGGCAAAAACAATCGATTGAGCAAATTGGAGCCTTGTTCTTGTTAATAGTTGCGGCAGTTCTTTTAAGTGTTGGCGAAGGCTCTACCAAAGGTTCTGCTATTGGCAATGCTGATCAAATTTTATTTTATGGAATTATTCCTGTATTAGTTGCTTCAGTGCTCTCTGGATTGGCTTCATCCTTGTGTCAATGGGCCTCTCAGGTTAAGAAACACTCATCATACTTGATGACTATAGAAATGTCTATTGTTGGAAGTCTATGTTTGCTTGCCAGTACTTTGAAATCTCCAGATGGGGAAGCTATGAGACAACATGGGTTTTTCTATGGTTGGACTCCTCTTACTTTGATCCCAGTAATTTTCAATGCCCTTGGAGGAATTCTTGTCGGTTTAGTTACAAGCCATGCTGGTGGTGTTCGGAAGGGGTTTGTCATTGTTTCTGCTTTACTCATTACAGCATTGCTACAGTTTATTTTCGATGGAAAGACACCTTCATTGTATTGCCTTTTGGCTCTTCCACTAGTGGTCACTAGCATTTCAATATACCAGAAATACCCCTACCAGGTTAAGAAGAAGGAGTCATAG

>Glyma08g14431.1   sequence type=predicted peptide   gene model=Glyma08g14431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPPAPPKSSQGQVMNNARIHFFSILLALQYGAQPLISKRFIRREVIVTSSVLTCELAKVICAVFFMAKDGSLRKLYKEWTLVGALTASGLPAAIYALQNSLLQISYKNLDSLTFSMLNQTKIFFTALFAYFILRQKQSIEQIGALFLLIVAAVLLSVGEGSTKGSAIGNADQILFYGIIPVLVASVLSGLASSLCQWASQVKKHSSYLMTIEMSIVGSLCLLASTLKSPDGEAMRQHGFFYGWTPLTLIPVIFNALGGILVGLVTSHAGGVRKGFVIVSALLITALLQFIFDGKTPSLYCLLALPLVVTSISIYQKYPYQVKKKES*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo