|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G65000 | AT | Annotation by Michelle Graham. TAIR10: Nucleotide-sugar transporter family protein | chr5:25965123-25967307 REVERSE LENGTH=325 | SoyBase | E_val: 5.00E-169 | ISS |
| GO:0008643 | GO-bp | Annotation by Michelle Graham. GO Biological Process: carbohydrate transport | SoyBase | N/A | ISS |
| GO:0010584 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pollen exine formation | SoyBase | N/A | ISS |
| GO:0015780 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide-sugar transport | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0000139 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: Golgi membrane | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0005338 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: nucleotide-sugar transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0005351 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity | SoyBase | N/A | ISS |
| KOG2234 | KOG | Predicted UDP-galactose transporter | JGI | ISS | |
| PTHR10231 | Panther | SUGAR TRANSPORTER | JGI | ISS | |
| PTHR10231:SF3 | Panther | gb def: putative protein [arabidopsis thaliana] | JGI | ISS | |
| PF04142 | PFAM | Nucleotide-sugar transporter | JGI | ISS | |
| UniRef100_B9SZ37 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: UDP-N-acetylglucosamine transporter, putative n=1 Tax=Ricinus communis RepID=B9SZ37_RICCO | SoyBase | E_val: 8.00E-180 | ISS |
| UniRef100_I1KT16 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KT16_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma08g14431 not represented in the dataset |
Glyma08g14431 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.08g135800 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma08g14431.1 sequence type=CDS gene model=Glyma08g14431 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCGCCACCGGCACCACCCAAGTCAAGTCAGGGTCAGGTGATGAATAATGCAAGGATTCACTTCTTTTCCATTCTCCTCGCTCTCCAATACGGTGCTCAACCTTTGATCTCCAAACGCTTCATCAGACGTGAAGTTATTGTGACTTCATCTGTTTTGACTTGTGAGCTTGCAAAGGTTATATGTGCAGTGTTTTTTATGGCAAAAGATGGTAGTCTGAGGAAATTGTATAAAGAGTGGACTTTGGTTGGTGCGTTGACTGCATCAGGACTTCCTGCAGCTATATATGCATTGCAAAATAGTTTGCTGCAAATTTCTTACAAGAATCTTGATTCACTCACATTCTCAATGCTGAATCAGACCAAAATATTTTTCACCGCGCTCTTTGCATATTTCATATTGAGGCAAAAACAATCGATTGAGCAAATTGGAGCCTTGTTCTTGTTAATAGTTGCGGCAGTTCTTTTAAGTGTTGGCGAAGGCTCTACCAAAGGTTCTGCTATTGGCAATGCTGATCAAATTTTATTTTATGGAATTATTCCTGTATTAGTTGCTTCAGTGCTCTCTGGATTGGCTTCATCCTTGTGTCAATGGGCCTCTCAGGTTAAGAAACACTCATCATACTTGATGACTATAGAAATGTCTATTGTTGGAAGTCTATGTTTGCTTGCCAGTACTTTGAAATCTCCAGATGGGGAAGCTATGAGACAACATGGGTTTTTCTATGGTTGGACTCCTCTTACTTTGATCCCAGTAATTTTCAATGCCCTTGGAGGAATTCTTGTCGGTTTAGTTACAAGCCATGCTGGTGGTGTTCGGAAGGGGTTTGTCATTGTTTCTGCTTTACTCATTACAGCATTGCTACAGTTTATTTTCGATGGAAAGACACCTTCATTGTATTGCCTTTTGGCTCTTCCACTAGTGGTCACTAGCATTTCAATATACCAGAAATACCCCTACCAGGTTAAGAAGAAGGAGTCATAG
>Glyma08g14431.1 sequence type=predicted peptide gene model=Glyma08g14431 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MAPPAPPKSSQGQVMNNARIHFFSILLALQYGAQPLISKRFIRREVIVTSSVLTCELAKVICAVFFMAKDGSLRKLYKEWTLVGALTASGLPAAIYALQNSLLQISYKNLDSLTFSMLNQTKIFFTALFAYFILRQKQSIEQIGALFLLIVAAVLLSVGEGSTKGSAIGNADQILFYGIIPVLVASVLSGLASSLCQWASQVKKHSSYLMTIEMSIVGSLCLLASTLKSPDGEAMRQHGFFYGWTPLTLIPVIFNALGGILVGLVTSHAGGVRKGFVIVSALLITALLQFIFDGKTPSLYCLLALPLVVTSISIYQKYPYQVKKKES*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||