SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g13700

Feature Type:gene_model
Chromosome:Gm08
Start:10034113
stop:10036255
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g13700
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G34650AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr2:14589934-14591557 REVERSE LENGTH=438 SoyBaseE_val: 0ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009734GO-bp Annotation by Michelle Graham. GO Biological Process: auxin mediated signaling pathway SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009958GO-bp Annotation by Michelle Graham. GO Biological Process: positive gravitropism SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0048766GO-bp Annotation by Michelle Graham. GO Biological Process: root hair initiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0048827GO-bp Annotation by Michelle Graham. GO Biological Process: phyllome development SoyBaseN/AISS
GO:0080167GO-bp Annotation by Michelle Graham. GO Biological Process: response to karrikin SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009986GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell surface SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
KOG0610 KOG Putative serine/threonine protein kinase JGI ISS
PTHR24351Panther RIBOSOMAL PROTEIN S6 KINASE JGI ISS
PTHR24351:SF88Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G7L9M4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein kinase G11A n=1 Tax=Medicago truncatula RepID=G7L9M4_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KSU2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KSU2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g13700
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g13700 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g171600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g13700
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g13700
>Glyma08g13700.1   sequence type=CDS   gene model=Glyma08g13700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTAGACACTGCTGAACGTGATTCTGAGGTGAGTTTGGAGACCGTCTATTCTTCCACACTTGGAAGCTCAATGAGCAGCGAGAGCATTTGTAGCACCAGTTTCAGCCGTCTTTCCTTCGATCTCCTCCCTCCCTCTCCGGAGACTCTCTCCATCAAGCCTCACCGCTCCTCCGACTTCGCCTACTCCGCCGCCTTCCGCCGCAAAGCCGCACTTACCTTCCGCGACTTCCACCTCCTCCGCCGCATCGGCGCCGGCGACATCGGCACCGTCTACCTATGCCGCCTCCACAACAGCAACCAATTGAAGAATCAGGATGAAGACGAAGAAGATGTTTCTTGTTTATACGCCATGAAAGTGGTGGACAAAGACGCAGTGGCATTGAAGAAGAAGTCGCAGAGAGCGGAAATGGAGAAAAAAATCCTCAAGATGCTCGACCACCCGTTCCTCCCTACGCTCTACGCCGAGTTCGAAGCTTCTCATTTCTCTTGCATCGTCATGGAGTTTTGTTCCGGTGGAGACTTGCACTCCCTGCGCTTCAAGCACCCTCACAACCGTTTCCCTCTCTCCTCCGCAAGATTTTATGCGGCGGAGGTGCTGGTGGCGTTGGAATACCTCCACATGCTGGGAATCATCTACAGAGATTTAAAGCCTGAGAACGTGTTGGTTAGATCAGACGGTCACATCATGCTTTCTGATTTCGATCTTTCTCTTTACTCAGAGGCAATCCCAGCCGTTGAATCCTCCCCAGATTCCTTACCATCTTCAAATGCATTACCATTACCTTACGCTTACACTCGCTCGCATTCTTTTATGAGTCCATTCTCCTGCTTCTCAAACCGGTCGCGCGAGGTTCGAACTATTGAACCGAATCGGCTTTTTGTTGCCGAACCGGTTTCGGCTCGGTCCTGTTCCTTTGTTGGGACCCACGAGTACGTCTCGCCGGAGGTCGCTTCTGGCCGGTCGCACGGGAACGCCGTGGACTGGTGGTCGTTTGGAGTATTTATCTACGAGCTCATCTACGGTCGCACGCCGTATGCGGGTCCATCGAAAGAGGCTACGCTGCGGAACATCGTAAAGAAACCACTGGCGTTCCCCACGGCCACACCAACGAGCAATCTTGAACTGCACGCGCGGGATTTGATATCCGGCTTGCTGAACAAGGATCCGGCGCGCCGGCTCGGCTCGAAGCGCGGCGCCGCTGACGTCAAAAAGCACCCCTTCTTTAAAGGGCTCAACTTGGCGCTGATTCGCATGCAGACGCCGCCCGAAGTGCCTGGCTCCAGAAGAAGGACCAAAACGACGTCGCTGTACCCCGTGAAGGGTAACGGCAACAACAACCATAAACAACAACAGACGGCGTCGTTTGATTTTTACTTCTAA
Predicted protein sequences of Glyma08g13700
>Glyma08g13700.1   sequence type=predicted peptide   gene model=Glyma08g13700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLDTAERDSEVSLETVYSSTLGSSMSSESICSTSFSRLSFDLLPPSPETLSIKPHRSSDFAYSAAFRRKAALTFRDFHLLRRIGAGDIGTVYLCRLHNSNQLKNQDEDEEDVSCLYAMKVVDKDAVALKKKSQRAEMEKKILKMLDHPFLPTLYAEFEASHFSCIVMEFCSGGDLHSLRFKHPHNRFPLSSARFYAAEVLVALEYLHMLGIIYRDLKPENVLVRSDGHIMLSDFDLSLYSEAIPAVESSPDSLPSSNALPLPYAYTRSHSFMSPFSCFSNRSREVRTIEPNRLFVAEPVSARSCSFVGTHEYVSPEVASGRSHGNAVDWWSFGVFIYELIYGRTPYAGPSKEATLRNIVKKPLAFPTATPTSNLELHARDLISGLLNKDPARRLGSKRGAADVKKHPFFKGLNLALIRMQTPPEVPGSRRRTKTTSLYPVKGNGNNNHKQQQTASFDFYF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo