Report for Sequence Feature Glyma08g12950
Feature Type: gene_model
Chromosome: Gm08
Start: 9467619
stop: 9469558
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g12950
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G13450 AT
Annotation by Michelle Graham. TAIR10: Adenine nucleotide alpha hydrolases-like superfamily protein | chr4:7815146-7815904 REVERSE LENGTH=219
SoyBase E_val: 5.00E-70 ISS
GO:0009827 GO-bp
Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification
SoyBase N/A ISS
GO:0009860 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen tube growth
SoyBase N/A ISS
GO:0048610 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction
SoyBase N/A ISS
GO:0048868 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen tube development
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF00582 PFAM
Universal stress protein family
JGI ISS
UniRef100_G7L828 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Universal stress protein family protein n=1 Tax=Medicago truncatula RepID=G7L828_MEDTR
SoyBase E_val: 2.00E-91 ISS
UniRef100_I1KSL4 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KSL4_SOYBN
SoyBase E_val: 2.00E-158 ISS
Expression Patterns of Glyma08g12950
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma08g12950
Paralog Evidence Comments
Glyma05g29850 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g12950 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g122800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g12950
Coding sequences of Glyma08g12950
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g12950.1 sequence type=CDS gene model=Glyma08g12950 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCGCAAGGCATGGCGAGTAACCGAAACCGGAACCCTTGCGCGCAAGAAGCGCGCAAGGTGATGGTGGTGGCGGACCCGACGCGGGAATCGGCGGGCGCGTTGCAGTACGCGCTTGCGCATGCGGTGATCGAACAGGACGAGCTGATTCTGCTGCACGTTGAGAACCCTAGCTCGTGGCGAAACACCATATCGACGTTCCTGAAGATGCCTTCGTTGGGAAGCAGCACCACTGCGTCGCTGGACCTCGGAGGAGGTGGAGGAGGGGGAGCAGCCGCGGCGCCGGACGGAGAAGGGTTGGATTTTCTGGAGGAGATGAAGCATGCATGTAGCGTTTCTCAGCCGAAAATGAAGGTGCGTGTGGTGAAGGTGGAGATGGATGGAAGAGACAAGGCTAGCATTGTTCTCTCGCAGAGCAAAACGCATGGGGTTGACGTCGTAGTTATAGGCCAGAAGCGCAATATTACTTCGGCCATATTAGGATACAAGCGACCTGCAAGTGGATCTATGAAAGGGGTGAAAGCGATAGACACTGCTGAGTATTTGATTCAAAACAGCTCGTGCACCTGTGTTAGTGTACAGAGAAAAGGCCAAAATGGAGGCTTTGTTCTCAACTCCAAAACCCACAGAAATTTCTGGCTCTTAGCCTAA
Predicted protein sequences of Glyma08g12950
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g12950.1 sequence type=predicted peptide gene model=Glyma08g12950 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAQGMASNRNRNPCAQEARKVMVVADPTRESAGALQYALAHAVIEQDELILLHVENPSSWRNTISTFLKMPSLGSSTTASLDLGGGGGGGAAAAPDGEGLDFLEEMKHACSVSQPKMKVRVVKVEMDGRDKASIVLSQSKTHGVDVVVIGQKRNITSAILGYKRPASGSMKGVKAIDTAEYLIQNSSCTCVSVQRKGQNGGFVLNSKTHRNFWLLA*