SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g12650

Feature Type:gene_model
Chromosome:Gm08
Start:9262211
stop:9265834
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g12650
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G18910AT Annotation by Michelle Graham. TAIR10: NOD26-like intrinsic protein 1;2 | chr4:10366211-10368179 FORWARD LENGTH=294 SoyBaseE_val: 1.00E-124ISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006857GO-bp Annotation by Michelle Graham. GO Biological Process: oligopeptide transport SoyBaseN/AISS
GO:0015700GO-bp Annotation by Michelle Graham. GO Biological Process: arsenite transport SoyBaseN/AISS
GO:0046685GO-bp Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0080170GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide transmembrane transport SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0015105GO-mf Annotation by Michelle Graham. GO Molecular Function: arsenite transmembrane transporter activity SoyBaseN/AISS
GO:0015250GO-mf Annotation by Michelle Graham. GO Molecular Function: water channel activity SoyBaseN/AISS
KOG0223 KOG Aquaporin (major intrinsic protein family) JGI ISS
PTHR19139Panther AQUAPORIN TRANSPORTER JGI ISS
PTHR19139:SF22Panther gb def: glycerol uptake facilitator protein [mycoplasma pulmonis] JGI ISS
PF00230PFAM Major intrinsic protein JGI ISS
UniRef100_I1KSI2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KSI2_SOYBN SoyBaseE_val: 0ISS
UniRef100_P08995UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nodulin-26 n=1 Tax=Glycine max RepID=NO26_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma08g12650
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g12650
ParalogEvidenceComments
Glyma05g29500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g12650 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g120100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g12650
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g12650
>Glyma08g12650.1   sequence type=CDS   gene model=Glyma08g12650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGATTATTCAGCAGGAACTGAATCCCAGGAGGTGGTCGTAAATGTAACCAAGAACACCTCCGAAACAATCCAACGCTCAGACTCCCTTGTCTCTGTTCCTTTCTTGCAGAAGTTGGTAGCTGAGGCGGTGGGAACATATTTCCTGATATTTGCAGGGTGTGCTTCATTGGTGGTGAACGAGAACTACTACAACATGATAACATTTCCTGGGATAGCAATTGTTTGGGGTCTGGTTCTGACGGTGTTGGTTTACACTGTCGGTCACATCTCTGGTGGCCATTTCAATCCTGCTGTCACCATTGCTTTTGCCTCCACCAGAAGATTCCCCTTGATCCAGGTACCAGCTTATGTAGTAGCTCAACTCCTAGGAAGCATACTTGCAAGTGGAACTCTGAGACTATTATTTATGGGGAATCATGACCAGTTTTCAGGAACAGTCCCAAATGGGACTAACCTGCAGGCTTTTGTGTTTGAATTCATAATGACCTTTTTCCTCATGTTCGTCATATGCGGGGTTGCCACCGATAACAGAGCGGTTGGTGAGTTGGCTGGGATTGCAATTGGGTCGACATTACTGCTGAATGTGATTATTGGAGGGCCAGTGACAGGAGCATCAATGAACCCAGCTAGAAGCCTAGGACCTGCTTTTGTACACGGTGAATACGAAGGAATATGGATATATTTGTTGGCACCTGTTGTGGGGGCCATAGCTGGAGCATGGGTATACAACATCGTTAGGTACACAGACAAGCCATTGAGTGAGATCACCAAGAGTGCTTCTTTCCTCAAAGGCCGTGCTGCCTCCAAATAA
Predicted protein sequences of Glyma08g12650
>Glyma08g12650.1   sequence type=predicted peptide   gene model=Glyma08g12650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADYSAGTESQEVVVNVTKNTSETIQRSDSLVSVPFLQKLVAEAVGTYFLIFAGCASLVVNENYYNMITFPGIAIVWGLVLTVLVYTVGHISGGHFNPAVTIAFASTRRFPLIQVPAYVVAQLLGSILASGTLRLLFMGNHDQFSGTVPNGTNLQAFVFEFIMTFFLMFVICGVATDNRAVGELAGIAIGSTLLLNVIIGGPVTGASMNPARSLGPAFVHGEYEGIWIYLLAPVVGAIAGAWVYNIVRYTDKPLSEITKSASFLKGRAASK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo