SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g12540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g12540): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g12540

Feature Type:gene_model
Chromosome:Gm08
Start:9191925
stop:9193428
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g12540
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G47260AT Annotation by Michelle Graham. TAIR10: ATP binding;GTP binding;nucleotide binding;nucleoside-triphosphatases | chr5:19189411-19192516 FORWARD LENGTH=948 SoyBaseE_val: 1.00E-11ISS
GO:0006499GO-bp Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0045036GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to chloroplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0043531GO-mf Annotation by Michelle Graham. GO Molecular Function: ADP binding SoyBaseN/AISS
PF00931PFAM NB-ARC domain JGI ISS
UniRef100_B9SQA5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Disease resistance protein RFL1, putative n=1 Tax=Ricinus communis RepID=B9SQA5_RICCO SoyBaseE_val: 5.00E-30ISS
UniRef100_I1KSG9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KSG9_SOYBN SoyBaseE_val: 7.00E-165ISS

Expression Patterns of Glyma08g12540
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g12540 not represented in the dataset
Glyma08g12540 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g12540 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g119000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g12540
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g12540
>Glyma08g12540.1   sequence type=CDS   gene model=Glyma08g12540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTAATTTGTGTTTGCAAAAGGAGGAGGAATGCGGCGCTAATGCTGGCTCGGGAGTGAAAAAAATATCCTGTCCTAGGAACGGAATATTAATGTTAGGTTCAGGCCGTCACGGGAGTATCATGCCCCCTGAATCCACAACCATAATTTTGAATGATATAATGACGGCTTTGAGACAACCAAATATTGGCATACTTGGGATGTATGGATCGAGTAATGCGAACACGGAAAATGCAGTGGAGAAAGTCACCAGAAGAGTTGAGAGGGACGGATTGTTTAATGTGGTTGTGAAGACATGCGTGATGAAAAAGTCAGATTTGAAAAAAATTCAAGGAGAACTTGGGAACGCATTGGGTCTACAACTCCATCAGAAAACTCTAGTGGAAAGAGCTACCCGTTTGTGTGAGAGGATTAAGATGGAGGACAACATCCTTATCATCCTTCATGATCTTCAAGCTCAAATCAACTTGGCCAAGATTGGAATACCCTTTGGGAATGACCACAAGGGTTGTAAAATCTTGTTAGTAGCTAAGAATAAAGAGGTGTTGTCCCACAAAATGAAAACCCAAATAGAATTTGCTGTGGACGAGGAGCCGTCAAGTTCTGGTCTAACGAGGAGCCATCAAGTTCAAACTCGTGGAGTAATTGTATGGATCAAAAGGTGGTGGTGTCCTGTCCAGTGA
Predicted protein sequences of Glyma08g12540
>Glyma08g12540.1   sequence type=predicted peptide   gene model=Glyma08g12540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSNLCLQKEEECGANAGSGVKKISCPRNGILMLGSGRHGSIMPPESTTIILNDIMTALRQPNIGILGMYGSSNANTENAVEKVTRRVERDGLFNVVVKTCVMKKSDLKKIQGELGNALGLQLHQKTLVERATRLCERIKMEDNILIILHDLQAQINLAKIGIPFGNDHKGCKILLVAKNKEVLSHKMKTQIEFAVDEEPSSSGLTRSHQVQTRGVIVWIKRWWCPVQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo