Report for Sequence Feature Glyma08g12030
Feature Type: gene_model
Chromosome: Gm08
Start: 8707632
stop: 8709931
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g12030
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G18100 AT
Annotation by Michelle Graham. TAIR10: Ribosomal protein L32e | chr4:10035715-10036475 REVERSE LENGTH=133
SoyBase E_val: 2.00E-82 ISS
GO:0006412 GO-bp
Annotation by Michelle Graham. GO Biological Process: translation
SoyBase N/A ISS
GO:0042254 GO-bp
Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis
SoyBase N/A ISS
GO:0005622 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: intracellular
SoyBase N/A ISS
GO:0005730 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleolus
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0005840 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: ribosome
SoyBase N/A ISS
GO:0022625 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit
SoyBase N/A ISS
GO:0022626 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome
SoyBase N/A ISS
GO:0003735 GO-mf
Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome
SoyBase N/A ISS
KOG0878
KOG
60S ribosomal protein L32
JGI ISS
PTHR23413 Panther
60S RIBOSOMAL PROTEIN L32 AND DNA-DIRECTED RNA POLYMERASE II, SUBUNIT N
JGI ISS
PF01655 PFAM
Ribosomal protein L32
JGI ISS
UniRef100_B9T5H6 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L32, putative n=1 Tax=Ricinus communis RepID=B9T5H6_RICCO
SoyBase E_val: 1.00E-88 ISS
UniRef100_I1KSB8 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KSB8_SOYBN
SoyBase E_val: 2.00E-92 ISS
Expression Patterns of Glyma08g12030
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma08g12030
Paralog Evidence Comments
Glyma05g28880 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g12030 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g114000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g12030
Coding sequences of Glyma08g12030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g12030.1 sequence type=CDS gene model=Glyma08g12030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCGGTGCCTCTGCTCTCAAAGAAGATCGTGAAGAAGAGGGTAAAGAAGTTCAAGAGGCCTCAGAGTGACAGGAAAATTTCCGTCAAGACTAACTGGCGCAGACCAAAGGGTATCGATTCTCGTGTTAGGAGAAAGTTCAAGGGATGCACTTTGATGCCAAACATTGGTTATGGTTCAGACAAGAAGACCCGCCACTATCTCCCTAATGGTTTCAAGAAATTTGTTGTTCACAATGTGAAGGATTTGGAACTGCTCATGATGCACAACAGGACTTACTGTGCTGAGATTGCCCACAATATATCCACAAGAAAGAGAAAAGATATAGTCGAGAGAGCCGCGCAGCTTGATGTTGTTGTGACAAACAAAACGGCCAGATTACGCAGCCAGGAGGATGAATAG
Predicted protein sequences of Glyma08g12030
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g12030.1 sequence type=predicted peptide gene model=Glyma08g12030 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAVPLLSKKIVKKRVKKFKRPQSDRKISVKTNWRRPKGIDSRVRRKFKGCTLMPNIGYGSDKKTRHYLPNGFKKFVVHNVKDLELLMMHNRTYCAEIAHNISTRKRKDIVERAAQLDVVVTNKTARLRSQEDE*