SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g11601

Feature Type:gene_model
Chromosome:Gm08
Start:8459075
stop:8459984
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g11601
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G23870AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF803) | chr3:8620253-8621755 FORWARD LENGTH=335 SoyBaseE_val: 2.00E-22ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR12570Panther UNCHARACTERIZED JGI ISS
PF05653PFAM Protein of unknown function (DUF803) JGI ISS
UniRef100_G7JA72UniRef Annotation by Michelle Graham. Most informative UniRef hit: Magnesium transporter NIPA2 n=1 Tax=Medicago truncatula RepID=G7JA72_MEDTR SoyBaseE_val: 6.00E-24ISS
UniRef100_I1KS77UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1KS77_SOYBN SoyBaseE_val: 1.00E-61ISS

Expression Patterns of Glyma08g11601
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g11601 not represented in the dataset
Glyma08g11601 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g11601
ParalogEvidenceComments
Glyma05g28580 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g11601 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma08g11601
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g11601
>Glyma08g11601.1   sequence type=CDS   gene model=Glyma08g11601   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGGATTGCAATACTAGCCCACTTTATCATAAAAGAGAGGTTGCACATATTTGGTGTGCTTGGATGTGCTCTTTGTATGGTGGGATCTACAATTATTGTGTTGCATGCTCCCCATGAAAGAGTTATTCACTCTGTTAAGGAAGTGTGGCAACTTGCTACAGAACCAGTCATTATCTGCTTTATTTATCTGAAACAGGAATGGGACACAGAAGATGCATCTCAAATTGCTACTGAGGTTTGTGGCTTTGTCACAATTTTATCCGGGACCTTTCTTCACAAAACCAAAGATATTGCAAATAGACCCGTAGAGCTTCCTGTTTTTACAAGTACTCCACAACATGATAATAGTCACTCAGGGACTTAA
Predicted protein sequences of Glyma08g11601
>Glyma08g11601.1   sequence type=predicted peptide   gene model=Glyma08g11601   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MWIAILAHFIIKERLHIFGVLGCALCMVGSTIIVLHAPHERVIHSVKEVWQLATEPVIICFIYLKQEWDTEDASQIATEVCGFVTILSGTFLHKTKDIANRPVELPVFTSTPQHDNSHSGT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo