Report for Sequence Feature Glyma08g11510
Feature Type: gene_model
Chromosome: Gm08
Start: 8376455
stop: 8378680
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma08g11510
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G23820 AT
Annotation by Michelle Graham. TAIR10: UDP-D-glucuronate 4-epimerase 6 | chr3:8603645-8605027 FORWARD LENGTH=460
SoyBase E_val: 0 ISS
GO:0005975 GO-bp
Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process
SoyBase N/A ISS
GO:0006569 GO-bp
Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process
SoyBase N/A ISS
GO:0009225 GO-bp
Annotation by Michelle Graham. GO Biological Process: nucleotide-sugar metabolic process
SoyBase N/A ISS
GO:0009684 GO-bp
Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process
SoyBase N/A ISS
GO:0044237 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular metabolic process
SoyBase N/A ISS
GO:0005768 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: endosome
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0005802 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0016857 GO-mf
Annotation by Michelle Graham. GO Molecular Function: racemase and epimerase activity, acting on carbohydrates and derivatives
SoyBase N/A ISS
GO:0050378 GO-mf
Annotation by Michelle Graham. GO Molecular Function: UDP-glucuronate 4-epimerase activity
SoyBase N/A ISS
GO:0050662 GO-mf
Annotation by Michelle Graham. GO Molecular Function: coenzyme binding
SoyBase N/A ISS
KOG1371
KOG
UDP-glucose 4-epimerase/UDP-sulfoquinovose synthase
JGI ISS
PTHR10366 Panther
NAD DEPENDENT EPIMERASE/DEHYDRATASE
JGI ISS
PTHR10366:SF42 Panther
UDP-GLUCOSE 4-EPIMERASE
JGI ISS
PF01370 PFAM
NAD dependent epimerase/dehydratase family
JGI ISS
UniRef100_G7JA85 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: UDP-D-glucuronic acid 4-epimerase n=1 Tax=Medicago truncatula RepID=G7JA85_MEDTR
SoyBase E_val: 0 ISS
UniRef100_UPI000233813A UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233813A related cluster n=1 Tax=unknown RepID=UPI000233813A
SoyBase E_val: 0 ISS
Expression Patterns of Glyma08g11510
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma08g11510
Paralog Evidence Comments
Glyma05g28510 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma08g11510 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.08g109100 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma08g11510
Coding sequences of Glyma08g11510
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma08g11510.2 sequence type=CDS gene model=Glyma08g11510 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTGTGTGTGTGTGGTAGTGAGAAGAATTGAGAAAAAGAATGTGGTCTCCAAAGTCCAACCAATACAAATCTCTAGCTCTCCCTCCCTCTCTCTTGTATCCCTTTATATGAATCTTCTCAGACACGTTTTCGAGAGCCCCTTTTTCCTTATCATAGCCTCGCAGCAGCTGATATCTCATGTTGTTCTTGTTCCTAACAAAGTAGCATTAAAAACCATGGCATCTTCACCGGACACCAGCAAAACCATAAAGCTGATGCGTTACAACAGCTACCTCCGCAGACTCAACAGCTTCAAACTCCTTAAGACATCCTTCATCCTCCTCCTCCTCCTCTACACCCTCTCCACCCACCACCTCCTCCTCTCCTCCGCCTTCCACGGCCCCGCATGGGAGAATCAGGTCCGCCACTCCGCCCTCCCCCGCCGCCCCCACGGCATGTCGGTGCTGGTCACCGGCGCGGCGGGCTTCGTTGGCTCCCACTGCTCCCTCTCCCTGAAGAAGCGCGGCGACGGCGTCCTCGGGCTCGACAACTTCAACTCCTACTACGACCCCTCCCTAAAACGCGCACGCCAGCACCTCCTCGCCAAACACCAAATCCTCATCATCGAAGCCGACCTAAACGACGCCCCGTTGCTCGCCAAGATCTTCGACGTCGTTTCGTTCTCCCACGTCCTCCACCTCGCAGCACAAGCGGGCGTCCGCTACGCCATGCAGAACCCCCACTCCTACGTGGCATCCAACATCGCCGGATTCGTAACTCTTCTAGAAGCTTCCAAAAACGCTAACCCCCAGCCCGCCATCGTTTGGGCCTCCTCGAGTTCCGTCTATGGGCTCAATGACGAAAGCCCATTCTCCGAACTCCACCGTACGGACCAGCCTGCGAGCCTCTACGCGGCAACTAAAAAAGCAGGCGAAGCAATCGCGCACACCTATAATCATATCTATGGACTCTCCCTCACCGGATTGCGCTTCTTCACTGTTTATGGGCCCTGGGGAAGGCCCGACATGGCTTACTTTTTCTTCACTAAGTCCATTCTCCAGAGAAAGCCCATTGACGTGTACCAGACGCATGACGAGAGAGAAGTCGCGCGTGACTTCACTTACATCGACGACGTCGTCAAGGGCTGCCTCGGTGCCCTCGACACGGCGGAGAAGAGCACCGGCGGCGTCGTAGGGAAGAAGCGCGGCCCCGCGCAGCTGAGAGTTTACAATCTCGGTAACACATCGCCGGTGCCGGTGGGTAAACTTGTTTCCGTGTTGGAGACGTTGCTCGGGGTAAAGGCGAAGAAGCACGTGATCAAAATGCCTCGAAACGGCGACGTTCCGTTCACGCATGCTAACGTGAGCTTGGCGTGGAGGGACTTGGGGTACAAGCCCACCACGGATCTCGCCGCTGGTCTCAGAAAGTTCGTGCAGTGGTACGTCGGGTATTATGGTGTTCGCTTAGGGGTAGAAAAGGAAAAACACGCAGACTTGGCTTGA
Predicted protein sequences of Glyma08g11510
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma08g11510.2 sequence type=predicted peptide gene model=Glyma08g11510 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MCVCVVVRRIEKKNVVSKVQPIQISSSPSLSLVSLYMNLLRHVFESPFFLIIASQQLISHVVLVPNKVALKTMASSPDTSKTIKLMRYNSYLRRLNSFKLLKTSFILLLLLYTLSTHHLLLSSAFHGPAWENQVRHSALPRRPHGMSVLVTGAAGFVGSHCSLSLKKRGDGVLGLDNFNSYYDPSLKRARQHLLAKHQILIIEADLNDAPLLAKIFDVVSFSHVLHLAAQAGVRYAMQNPHSYVASNIAGFVTLLEASKNANPQPAIVWASSSSVYGLNDESPFSELHRTDQPASLYAATKKAGEAIAHTYNHIYGLSLTGLRFFTVYGPWGRPDMAYFFFTKSILQRKPIDVYQTHDEREVARDFTYIDDVVKGCLGALDTAEKSTGGVVGKKRGPAQLRVYNLGNTSPVPVGKLVSVLETLLGVKAKKHVIKMPRNGDVPFTHANVSLAWRDLGYKPTTDLAAGLRKFVQWYVGYYGVRLGVEKEKHADLA*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
