SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma08g11110

Feature Type:gene_model
Chromosome:Gm08
Start:8109638
stop:8122504
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma08g11110
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G03710AT Annotation by Michelle Graham. TAIR10: K-box region and MADS-box transcription factor family protein | chr2:1129622-1131242 FORWARD LENGTH=187 SoyBaseE_val: 2.00E-37ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010076GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of floral meristem identity SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048441GO-bp Annotation by Michelle Graham. GO Biological Process: petal development SoyBaseN/AISS
GO:0048442GO-bp Annotation by Michelle Graham. GO Biological Process: sepal development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
KOG0014 KOG MADS box transcription factor JGI ISS
PTHR11945Panther MADS BOX PROTEIN JGI ISS
PTHR11945:SF19Panther MADS BOX PROTEIN JGI ISS
PF00319PFAM SRF-type transcription factor (DNA-binding and dimerisation domain) JGI ISS
PF01486PFAM K-box region JGI ISS
UniRef100_G3E7M7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Agamous-like 3 protein n=2 Tax=Glycine max RepID=G3E7M7_SOYBN SoyBaseE_val: 2.00E-133ISS
UniRef100_G3E7M7UniRef Annotation by Michelle Graham. Best UniRef hit: Agamous-like 3 protein n=2 Tax=Glycine max RepID=G3E7M7_SOYBN SoyBaseE_val: 2.00E-133ISS

Expression Patterns of Glyma08g11110
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma08g11110
ParalogEvidenceComments
Glyma05g28130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma08g11110 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.08g105400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma08g11110
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma08g11110
>Glyma08g11110.1   sequence type=CDS   gene model=Glyma08g11110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAAGAAGAAGGTGGAGATAAAGCGAATCGAGAACAAAAGCACTCGGCAGATAACATTCTCCAAGAGGCGCAATGGATTGATGAAGAAAGCTCGCGAGCTATCCATTCTCTGCGATGCGAAGGTGGCGCTGCTCATCTTCTCCAGCACCGGAAAGCTCTACGAGCTCTGCAACGGTGACAGTTTGGCCGAGGTCGTGCAGCAATATTGGGATCATTTAGGAGCGAGCGGTACTGACACAAAGTCGCAGGAACTATGCTTTGAAATTGCAGATATCTGGTCTGGTTCAGCGTTTTCTCAAATGATCAAAAGGCACTTCGGTGTTTCTGAACTTGAGCATCTGAGTGTGTCTGACCTTATGGAACTAGAGAAACTGACTCATGCTGCTCTTTCGCGAATCAGATCAGCAAAGATGCGATTGATGATGGAATCTGTAGTGAATCTTAAGAAAAAGATTGAGGCACTAGAAAAAACTAATGACGTCAATAACGTGGTGACACGGTCTATTGACTGTGATCAAACAGATGGGGTGACGCATAATCTGTTCCCAGGTCTCTAA
Predicted protein sequences of Glyma08g11110
>Glyma08g11110.1   sequence type=predicted peptide   gene model=Glyma08g11110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKKKVEIKRIENKSTRQITFSKRRNGLMKKARELSILCDAKVALLIFSSTGKLYELCNGDSLAEVVQQYWDHLGASGTDTKSQELCFEIADIWSGSAFSQMIKRHFGVSELEHLSVSDLMELEKLTHAALSRIRSAKMRLMMESVVNLKKKIEALEKTNDVNNVVTRSIDCDQTDGVTHNLFPGL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo