Glyma08g10740 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma08g10740): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma08g10740): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma08g10740

Feature Type:	gene_model
Chromosome:	Gm08
Start:	7814033
stop:	7816236
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma08g10740

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G40780	AT	Annotation by Michelle Graham. TAIR10: lysine histidine transporter 1 \| chr5:16323823-16327082 FORWARD LENGTH=445	SoyBase	E_val: 0	ISS
GO:0006499	GO-bp	Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006820	GO-bp	Annotation by Michelle Graham. GO Biological Process: anion transport	SoyBase	N/A	ISS
GO:0006862	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleotide transport	SoyBase	N/A	ISS
GO:0006865	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid transport	SoyBase	N/A	ISS
GO:0006888	GO-bp	Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0015696	GO-bp	Annotation by Michelle Graham. GO Biological Process: ammonium transport	SoyBase	N/A	ISS
GO:0015802	GO-bp	Annotation by Michelle Graham. GO Biological Process: basic amino acid transport	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0043069	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death	SoyBase	N/A	ISS
GO:0043090	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid import	SoyBase	N/A	ISS
GO:0043269	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of ion transport	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0015171	GO-mf	Annotation by Michelle Graham. GO Molecular Function: amino acid transmembrane transporter activity	SoyBase	N/A	ISS
KOG1303	KOG	Amino acid transporters	JGI		ISS
PTHR22950	Panther	AMINO ACID TRANSPORTER	JGI		ISS
PF01490	PFAM	Transmembrane amino acid transporter protein	JGI		ISS
UniRef100_G7ZZ20	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Lysine/histidine transporter (Fragment) n=1 Tax=Medicago truncatula RepID=G7ZZ20_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1KRZ0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1KRZ0_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma08g10740

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma08g10740 not represented in the dataset	Glyma08g10740 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma08g10740 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.08g101900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma08g10740

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma08g10740

Limit To All Plant Sequences

>Glyma08g10740.1   sequence type=CDS   gene model=Glyma08g10740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAACTGAAACTGAAAATGCTAATGATGCTGATATAAAGGCCATTAATGATTGGCTTCCTGTCACTGCCTCCCGAAATGCCAAATGGTGGTACTCTGCCTTCCACAACATCACTGCCATGGTTGGTGCTGGTGTCCTCACCCTTCCTTATGCCATGTCTATGATGGGCTGGGGTCCGGGGACAGTTATACTGCTCTTGTCATGGATGATCACGTTGTTTACCCTATGGCAAATGGTTGAGATGCACGAAATGGTACCTGGTGTGAGATTCGATAGGTATCATGAATTGGGGCAGCATGCCTTTGGAGAGAAGTTGGGTCTCTACATTGTGATTCCTCAACAACTACTTGTTCAGGTTGGCACATGCATTGTATATATGGTCACAGGAGGAACATCGCTAAAGAAGTTTCATGACACGGTTTGCCCCTCGTGTCAAAACATTAGGACCTCCTATTGGATTGCTATCTTTGGTTTTGTAAACTTCGTCCTCTCTTTGTGCCCCAACTTCAACTCTATTTCTGCTGTCTCTTTTGCCGCAGCAGTCATGTCTATCGCTTACTCAACCATTGCTTGGGTGGCTTCCATTGGCAAGGGAAAACTACCAGATGTGGACTATGGCTACAAAGCCCACAGCACTGCCGATGGTGTATTCAACTTCATGTTGGCCTTGGGAGAGGTGGCATTCTCCTATGCAGGTCACAATGTGGTTTTGGAAATCCAAGCAACAATACCTTCTACTCCTGAGAAACCTTCCAAGAAAGCCATGTGGAAAGGAGTTATATTTGCCTATTTAGGAGTTGCCTTTTGCTATCTCCCTGTGGCCTTCATTGGATATTATATATTTGGCAACTCTGTCCAGGATAATATCCTCATCACACTAGAAAAACCAACTTGGCTCATTGCTGCAGCCAACATGTTTGTTATTGTCCATGTTATTGGAGGCTATCAGGTATTCTCAATGCCGGTGTTTGACATCATCGAAACCTTTTTGGTGAAGCATTTAAAGTTTTCTCCTTGTTTTACACTCCGCTTTGTTGCTCGCACTGTATTTGTAGCAATGTCAATGTTAATTGCCATATGCATCCCGTTCTTCGGTTCTCTTCTTGGATTTCTAGGAGGATTTGCCTTTGCCCCAACATCATACTTTCTACCCTGTATCATCTGGCTTAAACTCTACAAACCAAAGAGATTTAGTTTGTCTTGGATAGTCAATTGGACATGCATTGTGCTTGGGATGCTATTGATGATACTAGCTCCAATTGGTTCGTTGAGAAAAATCATTGTTTCAGCGGCGAATTACAAGTTCTTTTCGTGA

Predicted protein sequences of Glyma08g10740

Limit To All Plant Sequences

>Glyma08g10740.1   sequence type=predicted peptide   gene model=Glyma08g10740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METETENANDADIKAINDWLPVTASRNAKWWYSAFHNITAMVGAGVLTLPYAMSMMGWGPGTVILLLSWMITLFTLWQMVEMHEMVPGVRFDRYHELGQHAFGEKLGLYIVIPQQLLVQVGTCIVYMVTGGTSLKKFHDTVCPSCQNIRTSYWIAIFGFVNFVLSLCPNFNSISAVSFAAAVMSIAYSTIAWVASIGKGKLPDVDYGYKAHSTADGVFNFMLALGEVAFSYAGHNVVLEIQATIPSTPEKPSKKAMWKGVIFAYLGVAFCYLPVAFIGYYIFGNSVQDNILITLEKPTWLIAAANMFVIVHVIGGYQVFSMPVFDIIETFLVKHLKFSPCFTLRFVARTVFVAMSMLIAICIPFFGSLLGFLGGFAFAPTSYFLPCIIWLKLYKPKRFSLSWIVNWTCIVLGMLLMILAPIGSLRKIIVSAANYKFFS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain